Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
DNA Synthesis PowerPoint Presentation
Download Presentation
DNA Synthesis

DNA Synthesis

502 Vues Download Presentation
Télécharger la présentation

DNA Synthesis

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. DNA Synthesis

  2. Sister chromatids DNA replication Centromere One chromosome (Unreplicated state) One chromosome (Replicated state) Last time: • DNA is the chemical substance that serves as the genetic material (exception: RNA in some viruses) • Today: • In order to pass on genetic material from parent (cell) to offspring (cell), the genetic material must be duplicated: DNA replication

  3. Cell free in vitro DNA synthesis reactions were used to identify the enzymes involved in DNA replication. • DNA replication requires : • Enzymes • DNA polymerase I: 1st enzyme to be identified-adds DNA nucleotides to a 3’ end • DNA polymerase III: main enzyme involved in DNA synthesis -adds DNA nucleotides to a 3’ end,can take away nucleotides at a 5’ end • Primase, helicase, topisomerase, DNA ligase • DNA replication requires a DNA template.

  4. DNA polymerases can only add to the 3’ of a growing DNA strand Completely single stranded 3' 5' Polymerase inactive G A A T C T G C Completely double stranded 3' 5' G A A T C T G C Polymerase inactive C T T A G A C G 5' 3' Single strand as template plus 3' end to start synthesis 5' 3' G A A T C T G C Polymerase active C T T OH 3' 5'

  5. Figure 16.14 Priming DNA synthesis with RNA III DNA ligase seals pieces together I

  6. Cell free in vitro DNA synthesis reactions were used to identify the enzymes involved in DNA replication. • Characteristics of replication in vitro in E. coli: • The new strands are initiated by adding nucleotides to a short RNA primer. • At the replication fork, DNA polymerase III builds the new strands in the 5’-3’ direction. • New nucleotides are only added to 3’ hydroxyl groups of other nucleotides.

  7. DNA polymerase III adds DNA nucleotides to the 3’end of a growing DNA strand Formation of the leading strand 3' DNA polymerase III 5' 5' RNA primer 3' 5' Replication fork Newly synthesized leading strand

  8. One strand is formed continuously (leading strand);the other strand is formed in pieces (lagging strand) 3' 5' Lagging strands 5' 3' 3' DNA polymerase III 5' 3' 5' RNA primer Okazaki fragments 5' RNA primer 3' DNA polymerase III beginning synthesis of new fragment 3' Gap 5'

  9. DNA replication is semi-discontinuous 3 Pol III synthesizes leading strand 2 1 Helicase opens helix Topoisomerase nicks DNA to relieve tension from unwinding Primase synthesizes RNA primer 4 5 Pol I excises RNA primer; fills gap 6 7 Pol III elongates primer; produces Okazaki fragment DNA ligase links Okazaki fragments to form continuous strand

  10. Figure 16.15 The main proteins of DNA replication and their functions III I

  11. Cell free in vitro DNA synthesis reactions were used to identify the enzymes involved in DNA replication. • Characteristics of replication in vitro in E. coli: • The leading strand is the new growing strand that follows the replication fork. • The lagging strand grows in the direction away from the replication fork and is synthesized in short pieces called Okazaki fragments, each with their own primer. • Different enzymes catalyze each step of the process.

  12. DNA replication is bidirectional

  13. Figure 16.10 Origins of replication in eukaryotes

  14. Laboratory Analysis of DNA Sequences • PCR uses the mechanism of DNA replication to allow scientists to produce many copies of a DNA fragment in vitro. • Small DNA samples (I.e., blood drops at a crime scene) can be amplified and analyzed

  15. Primers are required to run PCR CCCCATGCTTACAAGCAAGT Primer 3' 5' 3' 5' Primer Region of DNA to be amplified by PCR ATCCTATGGTTGTTTGGATGGGTG

  16. POLYMERASE CHAIN REACTION 3'5' 1. Start with a solution containing template DNA, synthesized primers, and an abundant supply of the four dNTPs. 5'3' 3' 5' 2. Denaturation Heating leads to denaturation of the double-stranded DNA. 3' 5' 3. Primer binding At cooler temperatures,the primers anneal to the template DNA by complementary base pairing. 5' 3'5' 5' 5'3'

  17. 5' 5'3' 3'5' 3'5' 4. Extension During incubation, DNA polymerase synthesizes complementary DNA strand starting at the primer. 5'3' 5'3' 5. Repeat cycle of three steps (2-4) again, doubling the copies of DNA. 6. Repeat cycle again, up to 20-30 times, to produce millions of copies of template DNA.