1 / 30

T HE F AITH OF AN E VOLUTIONIST

T HE F AITH OF AN E VOLUTIONIST. B IG B ANG. Singularity. Hubble Space Telescope. 10 B years. 1 B years. 2 B years. M ACRO E VOLUTION. OUTLINE. Current thinking about the universe … How much do we really know ???. The language of life … DNA … … What are the chances ???.

Ava
Télécharger la présentation

T HE F AITH OF AN E VOLUTIONIST

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. THE FAITHOF AN EVOLUTIONIST

  2. BIG BANG Singularity Hubble Space Telescope 10 B years 1 B years 2 B years MACRO EVOLUTION

  3. OUTLINE • Current thinking about the universe … How much do we really know ??? • The language of life … DNA … • … What are the chances ??? • What the Bible says • … Did GOD know what he was talking about ??? Some observations and philosophy Discussion Questions

  4. Professor Michael Turner The University of Chicago

  5. A FEW UNANSWERED QUESTIONS • Where did the singularity come from? • Where did the fundamental forces (gravity, electroweak, strong) come from? • Why do the most recent observations show that the universe is expanding at a a faster and faster rate, negating many aspects of the Big Bang theory? • What is space? • Only explanation for “dark matter” which is used to explain why galaxies rotate slower than they “should” is the recent observation that neutrinos might have mass. • Can knowledge exist exclusive of matter and energy?

  6. MACROEVOLUTION Chance and the right conditions produced the building blocks of life. Building blocks arranged themselves to form single cell organisms. More complicated and larger life forms evolved by mutations and survival of the fittest. Survival of the Fittest The fittest organisms survive to reproduce and propagate their DNA. How do we know they’re the fittest??…they survive. No a priori test to determine fittest. Macro Evolution requires lots of time and lots of “luck.”

  7. MICROEVOLUTION A natural or artificial biological change that involves minor chemical alterations, which result in a change of size, shape, and/or color. Genetic changes are a powerful tool for altering the look of a species. Genetic variety is pre-programmed into the chromosomes. MICRO + TIME  MACRO

  8. LAWOF BIOGENESIS Life comes only from life. Evolution is based on the premise of spontaneous generation (the emergence of life from inanimate matter). Spontaneous generation has NEVER been observed. The Bible says the dirt needed a little help… “And the LORD GOD formed man of the dust of the ground, and breathed into his nostrils the breath of life and man became a living soul.” – Genesis 2:7

  9. ISTIMEENOUGH ?? PRINCE Frog + 1 second KISS = Grimm’s Fables Frog + 500 Million Years = PRINCE Science

  10. THE FOSSIL “RECORD” • Piltdown man was a hoax; was in textbooks for 40 years. • Nebraska man was “created” from only one tooth, which turned out to belong to apig. • Java “man” was just a large gibbon. Other bones found in the same area supported this, but were suppressed. • Peking “man” was actually an ape that had been decapitated and used for food by real man. • For over 100 years, it was taught that Neanderthal “man” was stooped and ape-like. Recent studies show that the Neanderthals were crippled by arthritis and rickets. Martha’s Tip: “Always make sure your ape is fresh…there’s nothing worse than a bad monkey.”

  11. DNA THE LANGUAGE 4 colors - 4 bases Human DNA 3,000,000,000 Bases CTAGACTGGCTAGCTAGCTAACGATAGCTAGCTAGAATGCTAGCTAGAAACTGGATGGCTAGGATTGCGGATTCGGTATAGGCGATCGATGATCGATCGATGCTAGCTAGCTAGCTAGTA…………2.999999760 Billion omitted……. GCTAGATCGAGCTAGCTAGCTTAGCGAGGATCGGATCGGATTTAGCGAGAGAGCGAGAGTAGATCGATCGATAGCTTAGCTAGATCGATCGTAGATCGTAGCTGGCAAGCAAAGCGGATC Chromosome

  12. DNA…in other words… “The genetic information contained in each cell of the human body is approximately equivalent to a library of 4000 books.” [500 pages per book & 300 words per page] • Carl Sagan • The Dragons of Eden, NY: Random House, 1977, p.25

  13. How about other life forms?? Amoeba dubia: 670,000,000,000 “In the animal kingdom, the relationship between genome size and evolutionary status is not clear. One of the largest genomes belongs to a very small creature, Amoeba dubia. This protozoan genome has 670 billion units of DNA, or base pairs. The genome of a cousin, Amoeba proteus, has a mere 290 billion base pairs, making it 100 times larger than the human genome.” Amoeba proteus: 290,000,000,000 Bufo bufo: 6,900,000,000 Man: 3,000,000,000 Sizing up genomes: Amoeba is King, Edward Winstead, Celera website 2/12/2001

  14. What are the chances of randomly creating a DNA sequence, given the building blocks?? DNA sequence Goal: C A T G C C A T T C Probability of recreating the first 4 letters of the sequence (¼) (¼) (¼) (¼) (¼) (¼) = 1/256 = 0.39% (¼) (¼) Probability of recreating a 100 letter sequence T (¼)100 = 6.22 x 10-61 = 6.22 x 10–59 % = 0.0000000000000000000000000000000000000000000000000000000000622 % C G G A T C T C A G A Assumption: Unlimited number of letters. Same number of C, T, A, and G’s.

  15. DNA To replicate its DNA, a cell requires more than 75 different proteins. However, these proteins are produced only at the direction of DNA. Logic indicates that they must have come into existence simultaneously.

  16. MUTATIONS  UV light BEFORE AFTER { Mutated Sequence Most mutations have been experimentally shown to be non-beneficial, but precise quantification and qualification is extremely difficult outside a lab. Environment plays a large roll.

  17. MUTATIONS Total Beneficial *Non-Beneficial Chance Beneficial 1st Mutation 2nd Mutation 3rd Mutation 1 999 0.1 % 1 999 0.0001% 1 999 0.0000001% *Non-beneficial includes both neutral and harmful mutations How many beneficial mutations would you need to turn… a cat into a dog…. a mouse into a whale … a monkey into a man ???

  18. ADAM & EVE ?? “Southern African Eve,” Science 286, 229 (1999). Abstract: Scientists in South Africa have traced “Eve,” an ancestor common to all modern humans, to the Khosian, the oldest indigenous people in southern Africa. Gen 3:20 “And Adam called his wife’s name Eve, because she was the mother of all living.” “Y Chromosome shows that Adam was an African,” A. Gibbons, Science 278, 804 (1997). Abstract: Scientists have found men living in southern Africa whose Y chromosome may be the equivalent of the genetic “Adam.” Earlier evidence places the genetic Eve in the same area.

  19. THE EYE “To suppose that the eye with all its inimitable contrivances for adjusting the focus to different distances, for admitting different amounts of light, and for the correcting of spherical and chromatic aberration, could have been formed by natural selection, seems, I freely confess, absurd in the highest degree.” Charles Darwin, The Origin of the Species, p. 75

  20. What Chuck didn’t know To simulate 10 milliseconds of the complete processing of even a single nerve cell from the retina would require the solution of about 500 simultaneous differential equations 100 times…there are 10 million of more such cells interacting with each other in complex ways…” – John K. Stevens, “Reverse Engineering the Brain,” Byte, April 1985, p. 287. There are more than a dozen distinct types of eyes found throughout nature including “prehistoric” tribolites* which had eyes with compound lenses. * arthropods, the same phylum as insects and crustaceans such as the shrimp and crabs.

  21. THE HUMAN BRAIN • 10,000,000,000 Cells • 10,000 – 100,000 connections each • Total: 1,000,000,000,000,000 Connections The brain fits in a 1 liter box and uses about 10 watts of power. Can function with little to no maintenance for over 100 years and can be run on a diet of Coke, Doritos, and Twinkies. …or as I like to call these… “The Breakfast of Champions”

  22. MORE QUESTIONS… • How did Darwin reach his conclusions when he knew nothing of DNA, proteins, enzymes, or any other microscopic biological material? • How has Darwin’s theory persisted over 150 years, when most other scientific theories held at the time have been substantially changed? • Why is microevolution used to prove macroevolution, even though adaptability more strongly supports creation? • How did the eye evolve? What can a partially evolved eye see? • Why do some collections of atoms get so upset when you tell them they might have been created? • Is consciousness merely a “mechanical” process, or do we have a soul and spirit?

  23. SCIENTIFIC TRUTHS IN THE BIBLE Psalm 19: 1- 6 “ The heavens declare the glory of GOD, and the firmament shows his handiwork. Day unto day utters speech, and night unto night shows knowledge. There is no speech, nor language, where their voice is not heard. Their line is gone out through all the earth, and their words to the end of the world. In them has he set a tabernacle for the sun, which is as a bridegroom coming out of his chamber, and rejoices as a strongman to run a race. His going forth is from the end of the heaven, and his circuit unto the ends of it; and there is nothing hid from the heat thereof.

  24. SCIENTIFIC TRUTHS IN THE BIBLE Roman 1:20 – “For since the creation of the world His invisible attributes are clearly seen, being understood by the the things that are made, even His eternal power and Godhead, so that they were without excuse.” Book of Leviticus GOD gives the Israelites a long list of do’s and don’ts regarding cleanliness, human physiology, and disease. All have scientific merit and show knowledge which would not be scientifically understood until the last two centuries.

  25. SCIENTIFIC TRUTHS IN THE BIBLE Isaiah 42:5 – “Thus says the GOD the LORD, he that created the heavens, he that stretched them out; he that spread forth the earth; and which comes out of it; he that gives breath unto the people upon it, and spirit to them that walk therein.” Isaiah 45:12 – “I have made the earth; and created man upon it; I, even my hands, have stretched out the heavens, and all their host have I commanded.”

  26. SCIENTIFIC TRUTHS IN THE BIBLE Job 40: 15-20 – Behold now behemoth, which I made with thee; he eats grass like an ox. Lo now, his strength is in his loins, and his force is in the naval of his belly. He moves his tail like a cedar: the sinews of his stones are wrapped together. His bones are as strong pieces of brass; his bones are like bars of iron. He is the chief of the ways of GOD; he that made him can make his sword to approach unto him.” Isaiah 40:22 – It is he that sits upon the circle of the earth, and the inhabitants thereof are as grasshoppers; that stretches out the heavens as a curtain, and spreads them out as a tent to dwell in.”

  27. SCIENTISTS / PROFESSORS • Very few have personally researched evolution • Take the word of other scientists • Most research and technology has no basis in evolutionary theory. • Not uncommon to be ostracized and or persecuted for espousing anything that conflicts with evolutionary dogma. Evolution is accepted as the mechanism of the universe and all observations are made to fit into it.

  28. Naturalistic World View Nothing Something Knowledge Order

  29. GOD’s World View CREATION Something Order Life Knowledge Nothing JESUS CHRIST SIN

More Related