1 / 49

Genomes

Genomes. Chapter 21. Genomes. Sequencing of DNA Human Genome Project 1990-2003 6 countries 20 research centers. Genome. J. Craig Venter in 1992 Whole-genome shotgun approach Sequences random DNA fragments directly. Fig. 21-3-3. 1. Cut the DNA into overlapping fragments short enough

KeelyKia
Télécharger la présentation

Genomes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genomes Chapter 21

  2. Genomes • Sequencing of DNA • Human Genome Project • 1990-2003 • 6 countries • 20 research centers

  3. Genome • J. Craig Venter in 1992 • Whole-genome shotgun approach • Sequences random DNA fragments directly

  4. Fig. 21-3-3 1 Cut the DNA into overlapping fragments short enough for sequencing 2 Clone the fragments in plasmid or phage vectors. 3 Sequence each fragment. 4 Order the sequences into one overall sequence with computer software.

  5. Genomes • Complete genome sequences • Human, chimpanzee, • E. coli, brewer’s yeast • Nematode, fruit fly, house mouse,

  6. Genomes • Genomics: • Study of whole sets of genes & their interactions • Bioinformatics: • Application of computers • Storage & Analysis of biological data

  7. Genomes • Metagenomics • DNA • Entire groups of species • Environmental sample • Sequenced • Human “microbiome”

  8. Figure 21.1

  9. Genomes • Comparison • Evolutionary history of genes • Taxonomic groups

  10. Genome • Phenotype to genotype • Red eye fruit flies (w+w or w+w+) • Computer analysis of genome • Identifies sequences likely to encode proteins • Genotype to phenotype

  11. Genomes

  12. Genome • NCBI • Genbank • BLAST • Compare DNA Sequences • Compare predicted protein sequences • Domains (known aa sequences)

  13. Fig. 21-4

  14. tatggagaga ataaaagaac tgagagatct aatgtcgcag tcccgcactc gcgagatact 61 cactaagacc actgtggacc atatggccat aatcaaaaag tacacatcag gaaggcaaga 121 gaagaacccc gcactcagaa tgaagtggat gatggcaatg agatacccaa ttacagcaga 181 caagagaata atggacatga ttccagagag gaatgaacaa gggcaaaccc tctggagcaa 241 aacaaacgat gctggatcag accgagtgat ggtatcacct ctggccgtaa catggtggaa 301 taggaatggc ccaacaacaa gtacagttca ttaccctaag gtatataaaa cttatttcga 361 aaaggtcgaa aggttgaaat atggtacctt cggccctgtc cacttcagaa atcaagttaa 421 aataaggagg agagttgata caaaccctgg ccatgcagat ctcagtgcca aggaggcaca 481 ggatgtgatt atggaagttg ttttcccaaa tgaagtgggg gcaagaatac tgacatcaga 541 gtcacagctg gcaataacaa aagagaagaa agaagagctc caggattgta aaattgctcc 601 cttgatggtg gcgtacatgc tagaaagaga attggtccgt aaaacaaggt ttctcccagt 661 agccggcgga acaggcagtg tttatattga agtgttgcac ttaacccaag ggacgtgctg 721 ggagcagatg tacactccag gaggagaagt gagaaatgat gatgttgacc aaagtttgat 781 tatcgctgct agaaacatag taagaagagc agcagtgtca gcagacccat tagcatctct 841 cttggaaatg tgccacagca cacagattgg aggagtaagg atggtggaca tccttagaca 901 gaatccaact gaggaacaag ccgtagacat atgcaaggca gcaatagggt tgaggattag 961 ctcatctttc agttttggtg ggttcacttt caaaaggaca agcggatcat cagtcaagaa

  15. Genome • Proteomics: • Systematic study of all proteins encoded by a genome • Proteins carry out most of the cell’s activities

  16. Application • Finding DNA sequence of organisms • Predict structure & function of new proteins & RNA sequences • Families of related proteins • Phylogenic trees evolutionary relationships

  17. Application • The Cancer Genome Atlas project • Monitors 2,000 genes in cancer cells for changes • Mutations & rearrangements • Lung, ovarian and glioblastoma • Compare to normal cells

  18. Application • DNA sequencing • Highlight diseases • Specialize tx

  19. Genome size • Bacteria range from 1 to 6 million base pairs (Mb) • Eukaryotes usually larger • Humans have 3,200 Mb

  20. Table 21-1

  21. Fig. 21-UN1 Bacteria Archaea Eukarya Most are 10–4,000 Mb, but a few are much larger Genome size Most are 1–6 Mb Number of genes 1,500–7,500 5,000–40,000 Gene density Lower than in prokaryotes (Within eukaryotes, lower density is correlated with larger genomes.) Higher than in eukaryotes None in protein-coding genes Present in some genes Unicellular eukaryotes: present, but prevalent only in some species Multicellular eukaryotes: present in most genes Introns Other noncoding DNA Can be large amounts; generally more repetitive noncoding DNA in multicellular eukaryotes Very little

  22. Genome • Gene density: • Number of genes in a given length of DNA • Humans & other mammals-lowest • Multicellular eukaryotes have many introns • “Junk DNA”

  23. Genome • Genomes of humans, rats, & mice • 500 noncoding regions-are the same • 98.5% of the genome does not code for proteins, rRNAs, or tRNAs • 24% regulatory sequences & introns

  24. Fig. 21-7 Exons (regions of genes coding for protein or giving rise to rRNA or tRNA) (1.5%) Repetitive DNA that includes transposable elements and related sequences (44%) Introns and regulatory sequences (24%) Unique noncoding DNA (15%) L1 sequences (17%) Repetitive DNA unrelated to transposable elements (15%) Alu elements (10%) Simple sequence DNA (3%) Large-segment duplications (5–6%)

  25. Genome • Pseudogene: • Former genes, mutated • Repetitive genes: • Sequences in multiple copies

  26. Genome • Transposable elements: • DNA that move from one site to another • Prokaryotes & eukaryotes • Barbara McClintock

  27. Fig. 21-8

  28. Genome • Eukaryotic transposable elements • 1. Transposons: • Move within a genome • DNA intermediate • 2. Retrotransposons: • Move - RNA intermediate

  29. Fig. 21-9a New copy of transposon Transposon DNA of genome Transposon is copied Insertion Mobile transposon (a) Transposon movement (“copy-and-paste” mechanism)

  30. Fig. 21-9b New copy of retrotransposon Retrotransposon RNA Insertion Reverse transcriptase (b) Retrotransposon movement

  31. Genome • Alu elements • 10% of genome • Transposable elements • 300 nucleotides • Do not code for protein • Code for RNA

  32. Genome • Line-1 or L1 • 17% genome • Retrotransposons • 6500 nucleotides • Low transposition • Regulate gene expression • Developing neurons

  33. Genome • Repetitive DNA not transposons • 15% • 1. Long sequences of DNA • 2. Simple sequence DNA • Many copies of repeated short sequences • GTTACGTTACGTTACGTTACGTTAC

  34. Genome • Short tandem repeat (STR) • Repeating units of 2 to 5 nucleotides • Vary among individuals • Centromeres • Telomeres

  35. Genome • Multigene families: • Collections of identical or very similar genes on a haploid set of chromosomes • Example: • Code for rRNA products • Single transcript makes all rRNA molecules • Transcript sequence repeated many times

  36. Fig. 21-10a DNA RNA transcripts Nontranscribed spacer Transcription unit DNA 18S 5.8S 28S rRNA 5.8S 28S 18S (a) Part of the ribosomal RNA gene family

  37. Genome • Nonidentical genes • Hemoglobin • Chromosome 16-α globulin • Chromosome 11-ß globulin • Code separately • Animal development

  38. Fig. 21-10b Heme -Globin Hemoglobin -Globin -Globin gene family -Globin gene family Chromosome 16 Chromosome 11     G A 1 2 2 1    Fetus and adult Embryo Fetus Adult Embryo (b) The human -globin and -globin gene families

  39. Evolution • Human & chimpanzee genomes differ by 1.2% • More Alu elements in humans • Several genes are evolving faster in humans • Genes involved in defense against malaria and tuberculosis • Gene that regulations brain size • Genes that code for transcription factors

  40. Fig. 21-15 Bacteria Most recent common ancestor of all living things Eukarya Archaea 4 2 1 3 0 Billions of years ago Chimpanzee Human Mouse 70 60 40 50 30 20 10 0 Millions of years ago

  41. Evolution • FOXP2 gene • Vocalization • Mutation causes speech impairment • 2 aa difference chimps and humans

  42. Evolution • Humans 23 pairs of chromosomes • Chimpanzees 24 pairs • Humans & chimpanzees diverged from a common ancestor • 2 ancestral chromosomes fused in humans • Duplications & inversions result from mistakes during meiotic recombination

  43. Chimpanzeechromosomes Humanchromosome Telomeresequences Figure 21.11 Centromeresequences Telomere-likesequences 12 Centromere-likesequences 2 13

  44. Figure 21.12 Human chromosome Mouse chromosomes 16 17 7 8 16

  45. Ancestral globin gene Duplication ofancestral gene Figure 21.14 Mutation inboth copies β α Transposition todifferent chromosomes Evolutionary time α β Further duplicationsand mutations α ϵ β ζ  A  β G β α1 α2 ζ ϵ α α yθ ζ 1 2 α-Globin gene familyon chromosome 16 β-Globin gene familyon chromosome 11

  46. EGF EGF EGF EGF Epidermal growthfactor gene with multipleEGF exons Figure 21.16 Exonshuffling Exonduplication F F F F Fibronectin gene with multiple“finger” exons F K K EGF K Exonshuffling Plasminogen gene with a“kringle” exon Portions of ancestral genes TPA gene as it exists today

  47. Evolution • Evo-devo • Evolutionary developmental biology • Developmental processes in multicellular organisms • Genomic information shows minor differences in gene sequence or regulation • Results in major differences in form

  48. Evolution • Homeotic genes • Body segments (fruit fly) • 180-nucleotide sequence • Homeobox • Related homeobox sequences have been found in regulatory genes of yeasts, plants, and even eukaryotes

  49. Fig. 21-17 Adult fruit fly Fruit fly embryo (10 hours) Fly chromosome Mouse chromosomes Mouse embryo (12 days) Adult mouse

More Related