1 / 11

Biobrick

Biobrick. An adjective, not a noun. http://en.wikipedia.org/wiki/Biobrick. Overview. Short introduction to biobrick parts and plasmids How to make plasmids with biobrick parts How to combine the biobrick parts in one plasmid. B iobrick part in a plasmid.

aida
Télécharger la présentation

Biobrick

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Biobrick An adjective, not a noun http://en.wikipedia.org/wiki/Biobrick

  2. Overview • Short introduction to biobrick parts and plasmids • How to make plasmids with biobrick parts • How to combine the biobrick parts in one plasmid

  3. Biobrick part in a plasmid http://partsregistry.org/Help:An_Introduction_to_BioBricks

  4. The plasmid (backbone) http://partsregistry.org/Help:Plasmid_backbones/Glossary http://partsregistry.org/Help:Plasmids

  5. Construction plasmids http://partsregistry.org/Part:BBa_P1010

  6. Prefix & Suffix Prefix: GAATTCGCGGCCGCTTCTAGAGCTTCCGCGCCGGCGAAGATCTC EcoRIXbaISpeIPstINotI Suffix: TACTAGTAGCGGCCGCTGCAG ATGATCATCGCCGGCGACGTC Prefix cut with XbaI:...GCTT^CTAG AG...CGAA GATC^TC Suffix cut with SpeI:TA^CTAG TAGC...AT GATC^ATCG... SpeI + XbaI ...TA^CTAG AG......AT GATC^TC... http://partsregistry.org/Help:Plasmid_backbones/Glossary http://partsregistry.org/Help:BioBrick_Prefix_and_Suffix

  7. Standard assembly http://partsregistry.org/Help:Standard_Assembly_%28zoom%29

  8. RBS-CDS issues XbaI + SpeI (RBS)TA^CTAG AG(CDS)(RBS)AT GATC^TC(CDS) Scars: Normal:(RBS)TACTAGAG(CDS) Scar of 8 basesWith T:(RBS)TACTAGATG(CDS-ATG) Scar of 6 bases http://partsregistry.org/Assembly:RBS-CDS_issues

  9. Parallel/Rolling assembly http://partsregistry.org/Assembly:Rolling_assembly

  10. Robotic assembly epMotion5075 http://partsregistry.org/Assembly:Robotic_assembly

  11. Questions http://www.firstnews.co.uk/bored/can-you-do-this-word-search-i1919

More Related