1 / 21

Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver

Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver. Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad , Desirée Salazar, Roberto Tinoco , Rich Wilson Facilitators: Lisa Elfring and Ralph Preszler. Topic : Gene Expression: Linking Genes to Phenotypes

aida
Télécharger la présentation

Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver Brian Couch, Liz Flaherty, Carly Jordan, Susan Jorstad, Desirée Salazar, Roberto Tinoco, Rich WilsonFacilitators: Lisa Elfring and Ralph Preszler

  2. Topic: Gene Expression: Linking Genes to Phenotypes Context:Majors General Biology, 150+ students, mixed preparation, high DFW rate, different fields (ex, pre-health), diverse socioeconomic and ethnic groups, students at a state university Prior Knowledge: Protein structure, Mendelian genetics, transcription, translation

  3. Unit Learning Goals: • Understand the link between gene and phenotype • Understand how a mutation in DNA affects the amino acid sequence • Understand that a change in amino acid sequence can result in changes in protein function • Develop science process skills

  4. Teachable Tidbit Learning Outcomes: A. Give examples of how genotypic changes can lead to phenotypic changes (1) B. Given a wild type and mutant amino acid and/or mRNA sequences, identify the type of mutation that occurred (2) C. Compare and contrast the effects of different mutations on the resulting amino acid sequence (4) D. Design an experiment to test how amino acid sequence affects protein function (5) E. Draw a concept map that illustrates the relationships between genes and phenotypes (5) F. Interpret graphical data about biological phenomenon (4)

  5. Home Field Advantage: Why the Pittsburgh Steelers Don’t Like Playing in Denver

  6. Q1: What is Ryan’s genotype? A. He is homozygous for the normal allele. B. He is heterozygous. C. He is homozygous for the mutant allele. D. He is hemizygous.

  7. Q2: Which of the following contributes to sickle cell disease in Ryan? A. O2 levels B. Mutated DNA C. Abnormal protein D. All of the above E. Not enough information

  8. GROUP ACTIVITY! Let’s take a closer look at Ryan’s DNA!

  9. GROUP ACTIVITY! Let’s take a closer look at Ryan’s DNA! Ryan’s normal allele 5’ … CTATGGTGCACCTGACTCCTGAGGAGAAGT … 3’ Ryan’s mutant allele 5’ … CTATGGTACACCTGACTCCTGTGGAGAAGT … 3’

  10. Q3: Rank the following mutations (from low to high) with regards to the severity of their impacts on the final protein: • nonsense early in sequence • silent • missense mutation of valinefor alanine • missense mutation of valinefor lysine. A. 1, 2, 3, 4 B. 2, 3, 4, 1 C. 1, 2, 4, 3 D. 2, 3, 1, 4 E. 2, 4, 3, 1

  11. Q4: In each of Ryan’s red blood cells, what type of hemoglobin proteins are present? A. Normal and mutant hemoglobin B. Mutant hemoglobin C. Normal hemoglobin D. None since they lack nucleus E. It depends on oxygen levels

  12. Take-Home Activity For each treatment type, place an X in the box(s) that the treatment will resolve. Targets Treatment Type

  13. Alignment and Assessment • See hand-out

  14. Diversity • Highlight role model from an under-represented group • Disease range vs. homework question • Inequality in access to healthcare • Pedagogical diversity: group work, think-pair-share, data interpretation, concept maps, visual-auditory

  15. Assessment examples – Clicker questions and exam questions (concept map and experiment)

  16. Alignment Diversity:

  17. Think-Pair-Share How could this amino acid substitution change the shape of the protein and the cell? Protein Cell Image Source: Berkley’s “Understanding Evolution” Image Source: www.medindia.net

  18. Mutation

More Related