Advancements in Genomic Medicine: Cancer Diagnosis, Treatment, and Genome Sequencing
1.05k likes | 1.19k Vues
In his talk, Malcolm Campbell explores the fascinating world of genomic medicine, covering key topics such as the structure of the human genome, modern sequencing techniques, and innovative approaches to cancer diagnosis and treatment. He emphasizes how personalized medicine is reshaping cancer therapies, particularly for conditions like Diffuse Large B-Cell Lymphoma and breast cancer. By analyzing genetic activity patterns, we can improve treatment outcomes and tailor therapies to individual patients, shifting away from one-size-fits-all approaches and enhancing overall patient care.
Advancements in Genomic Medicine: Cancer Diagnosis, Treatment, and Genome Sequencing
E N D
Presentation Transcript
Genomic Medicine Malcolm Campbell James G. Martin Genomics Program Director Professor of Biology, Davidson College The Pines October 28, 2013
Outline of Talk What is a genome? How to sequence genomes? Diagnose and Treat Cancers Better? New Drugs from Failures: Iressa New Treatment Paradigms Gut microbiome
Science Presentation Give you the data, help you interpret.
Genetic information that you unique Human genome 3.4 billion base pairs G:C or A:T base pairs ~23,000 genes What is a Genome?
If the human genome were compiled in books: 200 volumes, 1000 pages each read 10 bases/second = 315,360,000 bases/year 9.5 years to read out loud (without stopping) What is the Human Genome?
Determine order of bases on all 23 (24) chromosomes Can only read 30 to 700 bases at a time Cannot sequence a genome in one run “Whole Genome Shotgun” sequencing How do you sequence a genome?
Determine order of bases on all 23 (24) chromosomes Can only read 30 to 700 bases at a time Cannot sequence a genome in one run “Whole Genome Shotgun” sequencing How do you sequence a genome?
Modern Genome Sequencing This is an analogy for genome assembly. This page will be torn into horizontal strips.
Modern Genome Sequencing This i s an is an
Modern Genome Sequencing This i s an is a
Modern Genome Sequencing This is an analogy for genome assembly. This page will be torn into horizontal strips. This i s an is a
You don’t know the language or syntax. This i s an is a
Huge Pile of Strips This i s an is a
Needle in a Haystack? This i s an is a
Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence
Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence
Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads high coverage low coverage consensus genome sequence
Modern Genome Sequence Assembly multiple copies of genome aligned sequencing reads consensus genome sequence
Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG
Reference Genome Assembly ATGGCATTGCAA TGGCATTGCAATTTG AGATGGTATTG GATGGCATTGCAA GCATTGCAATTTGAC ATGGCATTGCAATTT AGATGGTATTGCAATTTG AGATGGCATTGCAATTTGAC consensus
How do I remember them all? 206 bones > 60 organs
Think like a genomicist… 206 bones > 60 organs
Even Easier GCAT
Is there a better way to diagnose and treat cancers? Diffuse Large B Cell Lymphoma (DLBCL)
Diffuse Large B Cell Lymphoma (DLBCL) 25,000 new cases each year in America Half of patients die despite chemotherapy Why subject them to chemo if not helpful?
Who will benefit from chemotherapy? Brown and Botstein
Who will benefit from chemotherapy? patient and control biopsies control set
Retrospective Clinical Outcomes based on gene activity
Retrospective Clinical Outcomes based on gene activity traditional prediction
Retrospective Clinical Outcomes wrong 27% wrong 32%
Retrospective Clinical Outcomes wrong 37%
Resort Low Risk Patients wrong 37% wrong 29%
Six Key Indicator Genes Genes On Genes On LMO2 BCL6 FN1 BCL2 SCYA3 CCND2 chemo no chemo
Can Breast Cancer Treatment Be Improved? tissue biopsies
No Patterns Emerged control set patient biopsies
People Are More Unique Than Their Cancers before (BE) and after (AF) chemotherapy