Download

1 / 31

Text Annotation Techniques

Jul 11, 2012

310 likes | 455 Vues

Annotated text : (Eg.) Sample Document This is an annotated text document.. What is an

Share Presentation

Embed Code

Link

amos

Télécharger la présentation

Text Annotation Techniques

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Gene Prediction and Annotation techniques Basics

Gene Prediction and Annotation techniques Basics. Chuong Huynh NIH/NLM/NCBI Sept 30, 2004 huynh@ncbi.nlm.nih.gov. Acknowledgement: Daniel Lawson, Neil Hall. GATCGGTCGAGCGTAAGCTAGCTAG ATCGATGATCGATCGGCCATATATC ACTAGAGCTAGAATCGATAATCGAT CGATATAGCTATAGCTATAGCCTAT. What is gene prediction?.

1.19k views • 49 slides

Text Annotation Techniques

Annotated Text. Ordinary Text : (Eg.)This is an ordinary text document.. Annotated text : (Eg.)<html><title> Sample Document</title><body> This is an annotated text document.</body></html>. Document Type Definition (DTD). It is a specification that accompanies an annotated document. It ai

510 views • 31 slides

Text Annotation Techniques

What is an annotated" text ?. Ordinary Text : (Eg.)This is an ordinary text document.. Annotated text : (Eg.)<html><title>Sample Document </title><body>This is an annotated text document.</body></html>. Key Methods. DTDSGMLHTMLXMLWMLTEI. It is a specification that accompanies an annotate

589 views • 26 slides

Annotation

Annotation. As you read, circle any words that you do not know the meaning of, whether through context or definition. Put a question mark beside sentences or paragraphs that you have a question about. Paraphrase for understanding difficult passages. Highlight symbolism with yellow.

761 views • 48 slides

Collective annotation of wikipedia entities in web text

Collective annotation of wikipedia entities in web text. - Presented by Avinash S Bharadwaj (1000663882) . Abstract. The aim of the paper Annotation of open domain unstructured web text with uniquely identified entities in a social media like Wikipedia.

454 views • 28 slides

Text Recognition Techniques

Text Recognition Techniques. Group #2 Di Wu (d8wu) Ehren Choy (e3choy) Muhammad Qureshi (m2quresh) Mohammad Talha Khalid ( mtkhalid ). Problem. Recognize hand-written characters. Motivation. Hand-writing is a complex problem N eed AI techniques to help solve it. Remember A4?.

374 views • 17 slides

Text Annotation

Text Annotation. Soliciting knowledge from biologists Coordinating communication among biologists. Junichi TSUJII Microsoft Research Asia UK National Centre for Text Mining, UK . Plan of Talk. Text annotation for information extraction Current State of the Art :Event Recognition

803 views • 55 slides

Annotation

Annotation. Example 1: ACYLPHOSPHATASE (PTHR10029). vertebrate ACYP2. vertebrate ACYP1. duplication in vertebrate. Example 1: ACYLPHOSPHATASE (PTHR10029). insect. P rotoza. green plants. Archaea. Example 1: ACYLPHOSPHATASE (PTHR10029). Eubacteria. duplication. Archaea -

253 views • 9 slides

Annotation

Annotation. Students will… Understand what it means to annotate a text Understand the importance and use of annotation. What is annotation?. As an ACTIVE READER you should always be asking questions in your mind about the text.

533 views • 18 slides

Annotation

Annotation. Annotate and Underline (or Highlight) . Perhaps two of the most important things a student can do while reading for school—and reading anything really— is annotate and underline. Annotating is when you write a brief note to yourself in the margin of the text. . Annotation.

294 views • 8 slides

Annotation

Annotation. Annotation. Annotation is one way to slow down when reading difficult text so that you can understand it better Annotation includes underlining, highlighting, circling drawing arrows, writing in the margins and asking questions you may have

282 views • 6 slides

Annotation

Annotation. SPH 247 Statistical Analysis of Laboratory Data. Annotation. Given that one has found one of more genes that are differentially expressed, there are a number useful things to know What is the putative function? What pathways are know to contain this gene?

382 views • 13 slides

Annotation

Annotation. Canadian Culture. The significance of this sign!.

138 views • 5 slides

Ontology Based Annotation of Text Segments

Ontology Based Annotation of Text Segments. Presented by Ahmed Rafea rafea@claes.sci.eg Samhaa R. El-Beltagy Maryam Hazman . Agenda. Objective Problems related to AGROVOC Requirements of the Proposed Annotation System The Architecture of the Proposed Annotation System Evaluation

193 views • 8 slides

ANNOTATION

ANNOTATION. Critical Reading Strategy. Why annotate?.

196 views • 16 slides

Annotation

Annotation. The Key to Analysis. Why Annotate?. Annotation is a key component of close reading Effective annotating is both economical and consistent Makes reading easier and more efficient Helps you go back and find answers faster. Different Purposes for Annotation. Definitions

555 views • 13 slides

Functional Annotation of Genes Using Hierarchical Text Categorization

Functional Annotation of Genes Using Hierarchical Text Categorization. Svetlana Kiritchenko, Stan Matwin University of Ottawa, Canada and A. Fazel Famili National Research Council of Canada. Functional Annotation of Genes from Biomedical Literature. Previous Research.

153 views • 13 slides

Gene Prediction and Annotation techniques Basics

543 views • 49 slides

Professional Text Annotation Services With Us.

For machine learning models to recognize the text and its underlying intent requires properly annotated text datasets to be fed into machine learning algorithms, hence leading to the need for text annotation services. Get in Touch; https://www.damcogroup.com/text-annotation-services #TextAnnotationServices #DamcoSolutions

137 views • 12 slides

More Related