1 / 28

Chemoinformatics And Bioinformatics

Chemoinformatics And Bioinformatics. Cédric Notredame. Molecular Biology. Bioinformatics. Chemoinformatics. Chemistry. Bioinformatics and Chemoinformatics. Scale. Bioinformatics. Chemoinformatics. Sequences ----------(Structures)-----------Ligands/Lead. Genes Genomes. Drugs.

Télécharger la présentation

Chemoinformatics And Bioinformatics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry

  2. Bioinformatics and Chemoinformatics Scale Bioinformatics Chemoinformatics Sequences ----------(Structures)-----------Ligands/Lead Genes Genomes Drugs Proteins

  3. Bioinformatics and Chemoinformatics Describing the DATA Bioinformatics Chemoinformatics Sequences -----------(Structures)-----------Ligands ChainAtom Each Atom Chain AGCTGTCGAGGGATAGGACA TATACATAAATTAATATAAT SMILES, Sybyl, Matrices… Structure Descriptors Strings 3D-Structure

  4. Sequences -------------(Structures)---------------Ligands Bioinformatics and Chemoinformatics Storing the DATA Bioinformatics Chemoinformatics ChainAtom Each Atom Chain SMILES, Sybyl, Matrices, descriptors AGCTGTCGAGGGATAGGACA TATACATAAATTAATATAAT Strings 3D-Structure Chemical Structure Coordinates Sequence GenBank: Genomes CAPLUSREGISTRY… PDB Genpep/NR: proteins SwissProt

  5. Related Techniques Databases Bioinformatics: NCBI/EBI Chemoinformatics CAS/Beilstein/MDL Finding the right Database is NOT an issue as most data are public.

  6. Bioinformatics and Chemoinformatics Comparing the DATA Bioinformatics Chemoinformatics Sequences -----------(Structures)-----------Ligands Fold Similarity Descriptor Evolutionary model 3D-Model Descriptor Similarity Structure/StructureComparison Backtracking Algorithm Dynamic Programming LSQman DALI SAP CACTUS (Cactus.nci.nih.gov) BLAST

  7. Related Techniques Searching Databases Bioinformatics: Dynamic Programming Chemoinformatics Backtracking

  8. Bioinformatics and Chemoinformatics Building Models Bioinformatics Chemoinformatics Sequences -----------(Structures)-----------Ligands Fold MSA Descriptor Multiple Sequence Alignments ClustalW, TCoffee 3D-Model Classifications Descriptor Computation DALI SCOP CAT

  9. Related Techniques Profiles Bioinformatics: Chemoinformatics

  10. Bioinformatics and Chemoinformatics Predicting Properties Bioinformatics Chemoinformatics Sequences -----------(Structures)-----------Ligands Binding Function Descriptor Docking/Mecanisms QSAR Multiple Comparisons Profiles Pfam Relate descriptors to Molecular Dynamic Docking Predictions Function Structure Activity/Toxicity Phylogeny

  11. Related Techniques Profiles and Descriptors Bioinformatics: Chemoinformatics Pharmacophore Database Search With a Profile Database Search With a Profile

  12. Bioinformatics/ Chemoinformatics Each One in its Niche

  13. Bioinformatics and Chemoinformatics The Questions Bioinformatics: Target Chemoinformatics Lead Compound Database Target Site

  14. Bioinformatics and Chemoinformatics The Questions Evolutionary Trace Chemical Modelling

  15. Bioinformatics and Chemoinformatics The Questions Bioinformatics: Function Chemoinformatics QSAR Quantitative Structure-Activity Relationship Comparative Genomics Function Activity/Toxicity

  16. Bioinformatics and Chemoinformatics The Questions Bioinformatics: Target Chemoinformatics Lead 2D/3D QSAR Molecular Dynamic Comparative Genomics Molecular Dynamic Docking In Silico Screening

  17. Bioinformatics and Chemoinformatics The Algorithms Bioinformatics: Target Chemoinformatics Lead Graph Theory Neural Networks Genetic Algorithms Dynamic Programming Backtrace Hidden Markov Models

  18. Bioinformatics/ Chemoinformatics Where Do They Meet

  19. Homology based SAR predictions

  20. SAR Matrices contain affinity Data Homology based SAR predictions

  21. Targets can be clustered from the SAR Data Homology based SAR predictions

  22. Targets can be clustered using similarity Homology based SAR predictions

  23. Sequence Clustering Can be done using Key positions Homology based SAR predictions

  24. Sequence Clustering Can be done using Key positions Homology based SAR predictions

  25. Does it Work ??? Clustering Based on Active Site Residues Homology based SAR predictions

  26. Homology based SAR predictions • Pairs of Comparable Kinases

  27. Bioinformatics/ Chemoinformatics Main Differences ?

  28. Bioinformatics and Chemoinformatics Chemoinformatics Bioinformatics: Small Molecules Macro-molecules Chemical Modelling Evolutionary Signal

More Related