1 / 1

PNU

Primer S2. (A). (B). AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. AGAAGCTGGAAGAGTCAAAG GACACATTCTCCCCTCAAGC CCCAGTGGGA. Breast (C). Breast (N). GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC. Marker. GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACT AGACAGGGC.

aoife
Télécharger la présentation

PNU

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Primer S2 (A) (B) AGAAGCTGGAAGAGTCAAAGGACACATTCTCCCCTCAAGCCCCAGTGGGA AGAAGCTGGAAGAGTCAAAGGACACATTCTCCCCTCAAGCCCCAGTGGGA Breast (C) Breast (N) GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC Marker GCACGGCCCAGCTGGATTTTGGACTTCTGGCCTCCAGAACTAGACAGGGC Transcriptional regulation of mammalian LTR-retrotransposon element on the human Dorfin gene CTCACTGTGTCACCCAGGGTGGAATACAGTGGTGTGATCATAGCTCACTG CTCACTGTGTCACCCAGGGTGGAATACAGTGGTGTGATCATAGCTCACTG AluJ element CAGCCTGGAATTCCTGGGCTCAAGCAACCCTGCCACCTCAGCCTTCCAAG CAGCCTGGAATTCCTGGGCTCAAGCAACCCTGCCACCTCAGCCTTCCAAG 1 556 bp TAGCTAGGACTACAGAACATCCATGATAGCAGTCTTCTGTAAATCGAACT TAGCTAGGACTACAGAACATCCATGATAGCAGTCTTCTGTAAATCGAACT 2 430 bp Ja-Rang Lee1, Jae-Won Huh1, Dae-Soo Kim2, Kung Ahn1, Hong-Seok Ha1, Yun-Ji Kim1, Won-Ho Lee1, and Heui-Soo Kim1,2,* 3 315 bp TTTCAAGAATTCTCTGAAGGAACCAAGTAGGATATTCTTACATCATGACT TTTCAAGAATTCTCTGAAGGAACCAAGTAGGATATTCTTACATCATGACT G I M I E E Q K Y N E Q S F TAATGTGAATGCAAGAACAAGAAATAGGTTTTATCTCTAAATATAATGAA 1Division of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 609-735, Korea 2 PBBRC, Interdisciplinary Research Program of Bioinformatics, Pusan National University, Busan 609-735, Korea (C) TAATGTGAATGCAAGAACAAGAAATAGGTTTTATCTCTAAATATAATGAA P I D G T S I V N L V S L L C D T 1 2 3 11 GGGCTGTGTGTAAACACTGACCCTGTCTCAATTCTAACAAGCATTTTAGA AluJ MaLR GGGCTGTGTGTAAACACTGACCCTGTCTCAATTCTAACAAGCATTTTAGA 1) H R Q R S S D Q S S L M D G L M CATGAGTTTACATCGGCAAATGGGTTCAGATCGAGATCTTCAGTCCTCTG CATGAGTTTACATCGGCAAATGGGTTCAGATCGAGATCTTCAGTCCTCTG 1 2 10 M S L H R Q M G S D R D L Q S S AluJ MaLR 2) A S S V S L P S V K K A P K K R R CTTCATCTGTGAGCTTGCCTTCAGTCAAAAAGGCACCCAAAAAAAGAAGA CTTCATCTGTGAGCTTGCCTTCAGTCAAAAAGGCACCCAAAAAAAGAAGA A S S V S L P S V K K A P K K R R R I S I G S L F R K K D N K R K S ATTTCAATAGGCTCCCTGTTTCGGAGGAAAAAAGATAACAAACGTAAATC 1 2 11 3 ATTTCAATAGGCTCCCTGTTTCGGAGGAAAAAAGATAACAAACGTAAATC AluJ MaLR R I S I G S L F R K K D N K R K S 3) R E L N G G V D G I A S I E S I AAGGGAGCTAAATGGCGGGGTGGATGGAATTGCAAGTATTGAAAGTATAC AAGGGAGCTAAATGGCGGGGTGGATGGAATTGCAAGTATTGAAAGTATAC R E L N G G V D G I A S I E S I 115 bp 126 bp Primer AS2 Dorfin containing RING-finger and IBR motifs is an E3 ubiquitin ligase that is localized in Lewy bodies, a characteristic neuronal inclusion in Parkinson’s disease brains. The Dorfin gene located on human chromosome 8q22.2 has showed 4.4 kb transcript and expressed ubiquitously in various tissues including brain. Here we found its alternatively spliced transcript variants which derived from MaLR (mammalian LTR-retrotransposon) element using bioinformatic tools. The MaLR-derived promoter transcripts are detected as two different types in all tissues examined, while breast tissue only showed three variant types. Reporter gene assay of the promoter activity of MaLR element on Dorfin gene indicated good activity in human colon carcinoma cells (HCT-116). These findings suggest that the MaLR element acquired the role of transcriptional regulation of Dorfin gene during primate evolution.. category research genome Not searched in genome level Human cDNA sequence decision Expression pattern identification by nothern blot Transcripts expression research in ALS transcriptome 100 Dog Abstract Pig 77 100 proteome Identification of E3 activity Location decision of Dorfin in cell Phylogeny research in RBRfamily Homology research related with parkin Research about activity mechanism (VCP releated) Cattle 42 Mouse 100 Rat 100 Chicken Zebrafish Other region SINE 13% 16% Introduction LINE 20% HERV element 8% Gene-related Sequence 8 DNA element Pseudogene 3% 1% 36% Coding sequence 3% RING-finger/IBR 1a 1b 2 3 4 5 6 7 8 9 10 1 AluJ MaLR Dorfin (RNF19) 8q22.2 S1 AS1 ORF S2 AS2 S3 AS3 Expression of Dorfin gene by MaLR-derived promoter Relative Expression Lung Testis Cerebellum Kidney Bone marrow Skeletal muscle Adrenal gland Bone marrow Cerebellum Adult brain Spinal cord Fetal brain Fetal liver MaLR-derived promoter transcript (430 bp) MaLR-derived promoter transcript (556 bp) Materials & Methods Placenta Trachea Prostate Thymus Thyroid Marker Marker Kidney Uterus Testis Heart Lung Liver Dorfin gene structure Dorfin 494 bp 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 Modified PGL2-vector, HCT116, Cos7, Lipofectamine, Dual luciferase Assay Luciferase assay RT-PCR Luciferase assay - cloned from the anterior horn tissues Gapdh 195 bp Reverse Qiaquick Gel-extraction, Promega T-easy Vector, EcoR-I(DH5α) Cos7 HCT116 Gene cloning Forward Reverse Real-time PCR Gene cloning 35cycle 94 ℃ : 40sec 56 ℃ : 30sec 72 ℃ : 40sec. Forward RT-PCR Parkinson’s disease Amyotrophic lateral sclerosis Primer Design Control 0 2 4 6 8 10 12 14 16 18 20 22 40cycle (Sybr green) 94 ℃ : 10sec 56 ℃ : 15sec 72 ℃ : 15sec Real-time PCR Twenty Different Human tissue cDNAs Relative Luciferase Activity (Fold of pGL-2 control) Quantitative Analysis NM_015435.3  Results & Discussion PNU Evolutionary Conservation of the Dorfin Gene Expression of Dorfin gene by cellular promoter In silico analysis of transcription binding sites of MaLR element Promoter Activity of the MaLR Element CCCCACAAAA GATATGTTCA TGTCCTAATC CCCAGAATCT GCAAATGTTA TTTGGAAAAA GGGGTTTTGC AGATGTAATT AAGTTAAGAA TCTTGAGATAAGATCATCCT GGATTATCCA GGTAGCCTCA AAATCAAGTG ACAAGTGTCT TTGTAAGGGA CAAGTAGACC CATTACAGAG AAGACGACGC GCAGAAAAGG AGGAAGCAGT GTGCTCATGG AGGCGGAGAT TGGAGTGATG TAACCGCAAG CCGAGGAATG CTTATAGTCA CCAGAAGCTG GAAGAGTCAA AGGACACATT CTCCCCTCAA GCCCCAGTGG GAGCACGGCC CAGCTGGATT TTGGACTTCT GGCCTCCAGA ACTGTAAGAG AAATGTCCAT TGTCTTAAGC CAACCAGTTT GTGGTAGTTT GTTACAGCAG CCCCAGGAAA CTACTA . GATA-1 GATA-2 Nkx2-5 Nkx2-5 Whn ELF-1 References +1 TRANSCRIPTION START SITE Sin HS, Huh JW, Kim DS, Kang DW, Min DS, Kim TH, Ha HS, Kim HH, Lee SY, Kim HS. 2006. Transcriptional control of the HERV-H LTR element of the GSDML gene in human tissues and cancer cells. Arch. Virol. [Epub ahead of print] 1. Sin HS, Huh JW, Kim DS, Kang DW, Min DS, Kim TH, Ha HS, Kim HH, Lee SY, Kim HS. 2006. Transcriptional control of the HERV-H LTR element of the GSDML gene in human tissues and cancer cells. Arch. Virol. [Epub ahead of print] Hishikawa N, Niwa J, Doyu M, Ito T, Ishigaki S, Hashizume Y, Sobue G. 2003. Dorfin localizes to the ubiquitylated inclusions in Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, and amyotrophic lateral sclerosis. Am J Pathol. 163(2):609-619. 2. Hishikawa N, Niwa J, Doyu M, Ito T, Ishigaki S, Hashizume Y, Sobue G. 2003. Dorfin localizes to the ubiquitylated inclusions in Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, and amyotrophic lateral sclerosis. Am J Pathol. 163(2):609-619.

More Related