by Michael Y. Tolstorukov

1. by Michael Y. Tolstorukov Center for Biomedical Informatics, Harvard Medical School Division of Genetics, Brigham and Women’s Hospital Primary structure of chromatin: Sign posts of the genome

3. Stem cells and differentiation EPIGENETICS Aging Cancer

4. Human ENCODE (Encyclopedia of DNA Elements) Model organism ENCODE Road map to epigenomics ………… genome stored information DNA organized information chromatin epigenomes heterochromain euchromatin RNAp accessible plastic inaccessible restricted illustration from www.epigenome-noe.net

5. nucleosomes

6. DNA methylation Histone modifications nucleosomes Histone variants H2A – ‘major’ variant macroH2A H2A.Z H2A.Bbd H3.1/H3.3 …..

7. How big is a nucleosome? ~100 Å

8. Sequencing experiment

9. 5’  3’ Short reads sequencing data 3’ 5’

10. fine-grain density coarse-grain density 5’  3’ Short read sequencing data 3’ 5’ size dyad position Kharchenko, Tolstorukov, Park, Nature Biotech 2008 Tolstorukov et al., Genome Res 2009

11. Tolstorukov et al, Epigenomics, 2010

13. Distribution of stable nucleosome positions around transcription start sites -1 +1 +2 +3 NDR

14. Nucleosome positioning • Nucleosome composition • Future directions of my research

15. Is nucleosome positioning encoded in the genome? Two points of view: DNA sequence plays a major role in formation of the nucleosomal patterns Kaplan, Widom, Segal, et al. “The DNA-encoded nucleosome organization of a eukaryotic genome.” Nature 458, 362-6 (2009) Other factors mainly determine nucleosome positioning Zhang, Struhl, et al. “Intrinsic histone-DNA interactions are not the major determinant of nucleosome positions in vivo.” Nat Struct Mol Biol 16, 847-52 (2009)

16. 10-bp periodicity Major groove minor groove minor groove 10 bp DNA bending occurring every 10-bp into one of the grooves accumulates and this is favorable for nucleosome formation Some short sequence motifs, such as A-tracts, are known to introduce DNA bending 10-bp periodicity was first observed in nucleosomal sequences 30 years ago (Trifonov et al., PNAS, 1980)

17. CTGAACGTGGGTCTCAGTGGTGAGTAGCTGATG CTTCGCGTGTATCAGTGATGTCTGCAGCGTGAG ACTACCGTGTTCTCAGTGGTGAGTAGCTGGAAG Yeast WW [AA, TT, AT, TA] Human SS [GG, CC, GC, CG] Human WW [AA, TT, AT, TA] Yeast SS [GG, CC, GC, CG] Tolstorukov et al., Genome Res, 2009

18. Power spectral analysis of dinucleotide distribution in nucleosomal sequences

19. Other nucleosome positioning signals: Step-like profile of GC-content contributes to nucleosome positioning Human nucleosomes position relative to dyad, bp Kharchenko, Woo, Tolstorukov, et al. Genome Res, 2008 nucleosome deformation energy Tolstorukov et al., Mol Biol2007 Tolstorukov et al., Bioinformatics, 2008 position relative to dyad, bp

20. Are nucleosomal positions conserved?

21. Sequence variations around stable nucleosome positions in human genome Tolstorukov et al., Nat Struct Mol Biol, 2011

22. SNPs in gene-start proximal regions frequency distance, bp frequency distance, bp

23. Interplay between selection and mutability in chromatin context Transcription factors binding sites SNP rate Indel rate Selection Indels occurrence SNPs

24. Is nucleosome positioning encoded in the genome? Depends on organism and nucleosome type: Stronger role of sequence in lower organisms Stronger role of sequence in case of ‘epigenetic’ nucleosomes

25. Comparative profiling of histone H2A variants

26. Phylogeneticrelationship among H2A variants

27. H2A.Z

28. MacroH2A

29. H2A.Bbd

30. THE EXPERIMENT mac-FLAG H2A-FLAG Bbd-FLAG Z-FLAG Stable HeLa S3 Native chromatin IP and clone DNA for massively parallel sequencing (Solexa)

31. Tag density cross-correlation protected region is the number of tags whose 5’ end maps to the position x on the strand s of chromosome c, Nc, N are the number of tags mapped to chromosome c and the total number of tags

32. Over-digestion, internal cuts protected region Changes in nucleosome shape protected region

33. Tag density auto-correlation nucleosomal repeat

34. Snapshot of genome-wide distribution of H2A histone variants RNA-Seq H2A.Bbd macroH2A H2A.Z H2A

35. expression

36. H2A.Bbd is associated with elongating form of RNA Pol II

38. Functional and mechanistic aspects of H2A.Bbd story

39. Gene ontology analysis

40. shRNA-assisted depletion of H2A.Bbd affects expression phenotype

41. H2A.Bbd-enriched chromatin is associated with members of spliceosome and splicing factors U2 snRNP

46. Changes in exon inclusion rates upon H2A.Bbd depletion

47. 126 bp

48. Distinct roles of H2A variants Active transcription: Affects gene expression through interaction with spliceosome and elongating RNA Pol II Affects gene expression through interaction with TF, RNA Pol II H2A.Bbd H2A.Z TSS TTS Silencing: macroBbd TTS TSS

49. FUTURE RESEARCH DIRECTIONS

50. NHGRI Perspective Green et al. Charting a course for genomic medicine from base pairs to bedside. Nature, 2011 Understanding the structure of genomes Understanding the biology of genomes Understanding the biology of disease Advancing the science of medicine Improving the effectiveness of healthcare 1990–2003 Human Genome Project 2004–2010 2011–2020 Beyond 2020