890 likes | 1.02k Vues
This comprehensive review by Michael Y. Tolstorukov explores the intricate primary structure of chromatin, uncovering how it serves as a navigational guide for the genome in processes such as stem cell differentiation, aging, and cancer. The paper discusses key concepts in epigenetics, including nucleosome positioning, DNA methylation, and histone modifications, while referencing significant research and methodologies in the field, such as ChIP-Seq workflows. Critical insights into the roles of histone variants, including macroH2A and H2A.Z, further highlight their implications in gene regulation and chromatin dynamics.
E N D
by Michael Y. Tolstorukov Center for Biomedical Informatics, Harvard Medical School Division of Genetics, Brigham and Women’s Hospital Primary structure of chromatin: sign posts for the genome
Stem cells and differentiation EPIGENETICS Aging Cancer
DNA methylation Histone modifications nucleosomes Histone variants H2A – ‘major’ variant macroH2A H2A.Z H2A.Bbd H3.1/H3.3 …..
How big is a nucleosome? ~100 Å
RNAp Mod/Encode Road map to epigenomics illustration from www.epigenome-noe.net
Sequencing experiment (ChIP-Seq workflow illustration from www.illumina.com)
5’ 3’ Short reads sequencing data 3’ 5’
fine-grain density coarse-grain density 5’ 3’ Short read sequencing data 3’ 5’ size dyad position Tolstorukov et al., Genome Res 2009 Data from Barski et al, Cell 2007
Distribution of stable nucleosome positions around transcription start sites -1 +1 +2 +3
Nucleosome positioning Nucleosome composition Future directions of my research
Is nucleosome positioning encoded in the genome? Two points of view: DNA sequence plays a major role in formation of the nucleosomal patterns Kaplan, Widom, Segal, et al. “The DNA-encoded nucleosome organization of a eukaryotic genome.” Nature 458, 362-6 (2009) Other factors mainly determine nucleosome positioning Zhang, Struhl, et al. “Intrinsic histone-DNA interactions are not the major determinant of nucleosome positions in vivo.” Nat StructMol Biol 16, 847-52 (2009)
10-bp periodicity Major groove minor groove minor groove 10 bp DNA bending occurring every 10-bp into one if the grooves accumulates and this is favorable for nucleosome formation Some short sequence motifs, such as A-tracts are known to introduce DNA bending 10-bp periodicity was first observed in nucleosomal sequences 30 years ago (Trifonov et al., PNAS, 1980
CTGAACGTGGGTCTCAGTGGTGAGTAGCTGATG CTTCGCGTGTATCAGTGATGTCTGCAGCGTGAG ACTACCGTGTTCTCAGTGGTGAGTAGCTGGAAG Yeast WW [AA, TT, AT, TA] Human SS [GG, CC, GC, CG] Human WW [AA, TT, AT, TA] Yeast SS [GG, CC, GC, CG] Tolstorukov et al., Genome Res, 2009
Power spectral analysis of dinucleotide distribution in nucleosomal sequences
Sequence variations around stable nucleosome positions in human genome Tolstorukov et al, Nat Struct Mol Biol,2011
SNPs in gene-start proximal regions frequency distance, bp frequency distance, bp
Interplay between selection and mutability in chromatin context Transcription factors binding sites SNP rate Indel rate Selection Indels occurrence SNPs
Is nucleosome positioning encoded in the genome? Depends on organism and nucleosome type: Stronger role of sequence in lower organisms Stronger role of sequence in case of ‘epigenetic’ nucleosomes
Human H2A.Bbd Human macroH2A Human H2A.Z Talbert & Henikoff, Nat Rev Mol Cell Biol, 2010
mac-FLAG Bbd-FLAG Z-FLAG THE EXPERIMENT(J. Aaron Goldman, the Kingston Lab, MGH) H2A-FLAG Stable HeLa S3 Native chromatin IP and clone DNA for massive parallel sequencing (Solexa)
is the number of tags whose 5’ end maps to the position x on the strand s of chromosome c, Nc, N are the number of tags mapped to chromosome c and the total number of tags Tag density cross-correlation protected region Tolstorukov et al. submitted
is the number of tags whose 5’ end maps to the position x on the strand s of chromosome c are the number of tags mapped to strand s of chromosome c and the total number of tags Tag density auto-correlation
Snapshot of genome-wide distribution of H2A histone variants RNA-Seq H2A.Bbd macroH2A H2A.Z H2A
shRNA-assisted depletion of H2A.Bbd affects expression phenotype
H2A.Bbd-enriched chromatin is associated with members of spliceosome
Distinct roles of H2A variants Active transcription: Affects gene expression through interaction with spliceosome and elongating RNA Pol II Affects gene expression through interaction with TF, RNA Pol II H2A.Bbd H2A.Z TSS TTS Silencing: macroBbd TTS TSS
NHGRI Perspective Green et al. Charting a course for genomic medicine from base pairs to bedside. Nature, 2011 Understanding the structure of genomes Understanding the biology of genomes Understanding the biology of disease Advancing the science of medicine Improving the effectiveness of healthcare 1990–2003 Human Genome Project 2004–2010 2011–2020 Beyond 2020
Future directions: Overview Questions of general biological interest: Genomics of histone variants and modifications Pathways of establishment and maintenance of chromatin structure Methodological research Analysis and prediction of primary structure of chromatin Biomedical applications: Chromatin structure and disease Mutations causing changes in chromatin arrangement
Future directions: Methodology Developing a pipeline for the analysis of sequencing data with focus on nucleosome profiling -- correction of the possible experimental bias -- amplification; chromatin fragmentation; sequencing -- detection of regions of enrichment as well as stable positions -- non-canonical nucleosomes -- nucleosomes organizing less or more DNA than canonical nucs -- comparison of the data between epigenomes/organisms/development stages Integrative approach for prediction of primary structure of chromatin -- Nucleosome positing algorithms -- comparison of the algorithms and finding consensus in predictions
Different sequence ‘signature’ of two chromatin fragmentation methods Tolstorukov et al., Epigenomics, 2010
-- stiffness constants impeding DNA deformations Prediction of nucleosome positioning Deformation energy calculations Nduplex-- number of dinucleotide steps in DNA duplex Olson, Gorin, Lu, Hock, & Zhurkin, PNAS, 1998: NCP147 DNA sequence template: central 129 bp from NCP147 DNA structure [Davey et al., 2002] nuScore: http//compbio.med.harvard.edu/nuScore Tolstorukov et al., Bioinformatics, 2008
Future directions: Biological questions Genomics of histone variants and modifications -- evolutionary relation between H2A.Bbd and other histones/regulatory proteins -- profiling histone variants related to H2A.Bbd: H2AL1, H2AL2 -- comparison distribution in mouse and human -- co-occurrence of hisotne variants and modifications within the same genomic region single nucleosomes Factors affecting chromatin structure -- effects of chromatin remodelers of nucleosome profiles -- analysis of nucleosome positioning rules for nucleosomes of of different types in genomes of various complexity
Inactivation of chromatin remodeler and tumor suppressor Swi/Snf results in profound changes of nucleosome patterns at TSS