Real-Time RT-PCR Assay for Diagnosing HIV-1 Infection in Children from Blood Clot Specimens
This study presents a duplex, one-tube, one-step real-time RT-PCR assay designed to diagnose HIV-1 infection in children less than 18 months old born to HIV-infected mothers in Malawi. Blood samples collected by fingerstick at various ages were analyzed to detect HIV-1 viral sequences, addressing the challenge presented by maternal antibodies in children. The assay demonstrated high sensitivity and specificity, accurately identifying HIV-1 infection in the target population, crucial for timely intervention and treatment.
Real-Time RT-PCR Assay for Diagnosing HIV-1 Infection in Children from Blood Clot Specimens
E N D
Presentation Transcript
No. 39 Materials and Methods REAL-TIME RT-PCR BASED ASSAY ON BLOOD CLOT SPECIMENS FOR DIAGNOSIS OF HIV-1 INFECTION IN CHILDREN, MALAWI CDC, Mail Stop D-12 1600 Clifton Road Atlanta, GA 30333 cyang1@cdc.gov 404-639-4975 Hua Yang1, Rita Helfand2, Desiree Witte3, Ashley C. LaMonte2, Yashieka Blount1, Robin Broadhead3, Felicity Cutts4, Richard Fudzulani3, Chin-Yih Ou1, Renu B. Lal1, Chunfu Yang1 1Divisions of HIV/AIDS Prevention, NCHSTP and 2Division of Viral and Rickettsial Diseases, NCID, CDC, Atlanta; 3University of Malawi; 4London School of Hygiene and Tropical Medicine • Participants are part of a study of Measles vaccination of HIV-1 infected and –uninfected children born to HIV-1 infected mothers from outside of Blantyre, Malawi. • One milliliter of blood was collected by fingerstick at 6, 9, 12, 18-24 and 30-36 months of age. HIV rapid tests, Unigold and Determine were performed on blood collected ≥ 18 months. • Sera were collected for anti-Measles antibody testing, the remaining blood clots were stored at -20°C freezer for HIV-1 viral sequence detection. Abstract Summary • Background:Mother to child HIV-1 transmission is the most common route of HIV-1 infection in children. HIV antibody testing is unreliable for children born to HIV-infected mothers under 18 months of age due to maternal antibodies. Therefore, in children younger than 18 months of age, HIV-1 infection is diagnosed by detecting HIV-1 viral sequences. We have developed a duplex, one-tube, one-step real-time RT-PCR-based assay for HIV-1 diagnosis. In this study, we evaluated this assay for its ability to detect HIV infection in blood clot specimens in children born to HIV-1-infected mothers under the age of 18 months in Malawi. • Methods: We collected 1ml of blood by fingerstick at 6, 9, 12, 18-24, and 30-36 months of age during a study of measles vaccination of HIV-infected and -uninfected children outside of Blantyre, Malawi. We performed HIV rapid antibody testing on blood collected > 18 months of age from children born to HIV-infected mothers. Antibody positivity ≥ 18 months was taken as the indicator of HIV-1 infection in children. Total nucleic acids were extracted from blood clot specimens following digestion with streptokinase, and real-time RT-PCR was performed using the primers in the HIV-1 LTR region. We tested blood clots from 34 children with positive HIV antibody results and 24 of 146 children with negative HIV antibody tests. • Results: To evaluate the sensitivity and specificity of the assay, we first tested 34 children who were consistently HIV antibody positive ≥ 18 months of age and all of them had positive RT-PCR results from samples taken on at least two time points. We then tested 24 HIV-1 antibody negative children. Of the 24 children, 23 were HIV-1 negative by RT-PCR while one had positive HIV-1 RT-PCR at 6, 12, 18 and 24 months and undetectable antibody at 18 and 24 months by two rapid HIV tests. HIV infection was confirmed in this child by amplification of the HIV-1 gag region and sequencing. • Conclusion: The one tube and one step Real-time RT-PCR used here was both sensitive and specific in detecting true HIV-1 infection from blood clot specimens in children born to HIV-1-infected mothers under the age of 18 months. Results • In this study, we used a duplex, one-tube, one step real-time RT-PCR assay to detect HIV-1 infection from blood clot specimens collected from children born to HIV-1 infected mothers from Blantyre, Malawi. • We tested 34 children who were HIV antibody positive the age of ≥18 months using two rapid tests, Unigold and Determine, and all of them had positive RT-PCR results, giving a 100% testing sensitivity. • We also tested 24 children with negative HIV antibody tests. 23 of them had negative HIV-1 RT-PCR results while one child gave positive RT-PCR results at 6, 12, 18 and 24 months. HIV status of the child was further confirmed by the amplification and sequencing of the gag gene. • Based on the excellent sensitivity and specificity of the assay, we then tested 144 children who didn’t have HIV antibody tests due to unavailable specimens ≥ 18 months. We found 32 had two positive RT-PCR, 28 had one positive RT-PCR; 61 had two negative RT-PCR and 23 had one negative RT-PCR. Sensitivity of the Assay RT-PCR positive (month) No. of specimens (34) 6 9 12 18 20 24 30 HIV rapid tests positive ≥ 18 months 10 + + 9 + + + 4 + + Digestion of blood clots with streptokinase and extraction total nucleic acid Real Time RT-PCR 3 + + 2 + For a 25 μL of real-Time RT-PCR Reaction 2 + Blood clot specimens 1 + + + • Add 12.5 μL of QuantiTect Probe RT-PCR Master Mix • 0.25 μL of /Quantitect RT Mix • 1 μL of HIV-1-specific primer and probe mix • 1 μL of Human RNAse P primer and probe mix • 0.25 μL of RNase-free water Add 300 μL of PBS 1 + + + 1 + + Add 20 units/vial of Streptokinase 1 + Incubate at 37°C for O/N 15 μL Distribution of HIV-1 RT-PCR positivity based on the first positive RT-PCR Add 10 μL of total nucleic acid extract Extract total nucleic acid with QIAamp Blood DNA mini kit using 200 μL of the O/N digests Real Time RT-PCR: 50°C, 30 minutes; 95°C, 15 minutes; 60 cycles at 95°C for 15 second, 52°C for 1 minutes Conclusions • The duplex, one tube, one step real-time RT-PCR used here was both sensitive and specific in detecting true HIV-1 infection from blood clot specimens in children born to HIV-1-infected mothers under the age of 18 months. • This study confirms that blood clot specimens can be used for the detection of HIV viral sequences, opening a new avenue for HIV detection in children in terms of specimen specification. Introduction Primers and Probes • Mother to child HIV-1 transmission (MTCT) is the most common route of HIV-1 infection in children despite the advantage of ARV. • Because of maternal antibodies, HIV-1 infection in children born to HIV-1 infected mothers under the age of 18 months is diagnosed by detecting HIV-1 viral sequences. • Although HIV-1 DNA PCR assay for HIV-1 diagnosis is commercially available, it is expensive and labor intensive for resource-limited countries. • Here we report an adaptation of a duplex, one-step real-time RT-PCR assay for detection of HIV-1 total nucleic acid using blood clot specimens for the diagnosis of HIV-1 infection in children born to HIV-1 infected mothers. Gene Sequences Functions Specificity of the assay HIV-1 LTR 5’tgcttaagcctcaataaagcttgccttga Forward Primer HIV-1 LTR 5’:tctgagggatctctagttaccag Reverse Primer HIV-1 LTR 5’Fam-aagtagtgtgtgcccgtctgt-Qsy-7 Probe RNaseP 5’ agatttggacctgcgagcg Internal Control Farward Primer RNaseP 5’gagcggctgtctccacaagt Internal Control Reverse Primer * This child was HIV-1 real-time RT-PCR positive at 6, 12, 18 and 24 months. RNaseP 5’Hex-ttctgacctgaaggctctgcgcg-Qsy-7 Probe