1 / 49

Automated Searching of Polynucleotide Sequences

Automated Searching of Polynucleotide Sequences. Michael P. Woodward Supervisory Patent Examiner - Art Unit 1631 571 272 0722 michael.woodward@uspto.gov John L. LeGuyader Supervisory Patent Examiner - Art Unit 1635 571 272 0760 john.leguyader@uspto.gov. Standard Databases.

axel-copeland
Télécharger la présentation

Automated Searching of Polynucleotide Sequences

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Automated Searching of Polynucleotide Sequences Michael P. Woodward Supervisory Patent Examiner - Art Unit 1631 571 272 0722 michael.woodward@uspto.gov John L. LeGuyader Supervisory Patent Examiner - Art Unit 1635 571 272 0760 john.leguyader@uspto.gov

  2. Standard Databases • GenEMBL .rge • N_Genseq .rng • Issued_Patents_NA .rni • EST .rst • Published_Applications_NA .rnpb

  3. Databases at Time of Allowability • Pending_Patents_NA_Main .rnpm • Pending_Patents_NA_New .rnpn

  4. Types of Nucleotide Sequence Searching • Standard (cDNA) • Oligomer • Length Limited Oligomer • Score over Length

  5. Types of Nucleotide Sequence Searching • Standard (cDNA) • useful for finding full length hits • the query sequence is typically the full length of the SEQ ID NO: • the search parameters are the default parameters-Gap Opening Penalty & Gap Extension Penalty of 10 • standard suite of NA databases are searched • normally 45 results and the top fifteen alignments are provided, however, additional results and alignments can be provided.

  6. Standard (cDNA) search • Fragments and genomic sequences are often difficult to find • Fragments are buried in the hit list • The presence of introns in the database sequence results in low scores.

  7. Types of Nucleotide Sequence Searching • Standard Oligomer • finds longest matching hits – mismatches not tolerated in region of hit match • Length Limited Oligomer • returns database hits within length range requested • mismatches not tolerated in region of hit match

  8. Standard Oligomer Searching • Only provides the longest oligomer present in the sequence • A thorough search of fragments requires multiple searches • Can be an effective way of finding genomic sequences

  9. Standard Oligomer Searching • the search parameters are the default parameters-Gap Opening Penalty & Gap Extension Penalty of 60-mismatches not tolerated • Consequently inefficient means of finding small sequences, and with <100% in correspondence

  10. Claim 1 • An isolated polynucleotide comprising SEQ. ID. No: 1.

  11. Searching Claim 1 • A standard search looking for full length hits is performed.

  12. Standard (cDNA) search result 0001 CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGATGG 0060 2031 CGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGG---CAGATGG 2090

  13. Claim 2 • An isolated polynucleotide comprising at least 15 contiguous nucleotides of SEQ. ID. No: 1.

  14. Searching Claim 2 • An standard oligomer search is performed with an oligomer length of 15 nucleotides set as the lower limit for a hit.

  15. Oligomer Search Results Standard Oligomer CAAATGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG Query CCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 0060 Database CCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 2500 Length Limited Oligomer CAAATGCAGGCCCCCGGACCTCCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG  Query CCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 0060 Database CCCTGCTCCTGGCTTTCGCCCTGCTCTGCCTGCCCTGG 0039

  16. Claim 3 • An isolated polynucleotide comprising a polynucleotide encoding a polypeptide of SEQ ID No: 2. • (SEQ ID No: 2 is an Amino Acid (AA) sequence)

  17. Searching Claim 3 • Seq ID No: 2 is searched against the Polypeptide databases and it is “back translated” and searched against the polynucleotide databases.

  18. Claim 4 • An isolated polynucleotide comprising a polynucleotide with at least 90% identity to SEQ ID No: 1.

  19. Searching Claim 4 • A standard search looking for full length hits is performed. • Hits having at least 90% identity will appear in the results.

  20. Claim 5 • An isolated polynucleotide comprising a polynucleotide which hybridizes under stringent conditions to SEQ ID No: 1.

  21. Searching Claim 5 • A standard oligomer search is performed as well as a standard search.

  22. Searching Small Nucleotide Sequences John L. LeGuyader

  23. Types of Small Nucleotide Sequences Claimed • Fragments • Complements/Antisense • Primers/Probes • Oligonucleotides/Oligomers • Antisense/RNAi/Triplex/Ribozymes (inhibitory) • Accessible Target/Region within Nucleic Acids • Aptamers • Nucleic Acid Binding Domains • Immunostimulatory CpG Sequences

  24. Small Nucleotide Sequences Claimed as Sense or Antisense? • What is being claimed? • Requesting the correct sequence search starts with interpreting what is being claimed • Complementary Sequences • DNA to DNA: C to G • DNA to RNA: A to U • Matching Sequences • A to A • U to U • DNA, RNA, Chimeric • cDNA, Message (mRNA), Genomic DNA

  25. Impact of Sequence Identity and Length • Size and Identity Matter • Complements/Matches • 100% correspondence • Mismatches - Varying Degrees of Percent Identity • Gaps - Insertion or Deletions - Gap Extensions • Wild Cards • % Query Match value approximates identity • Adjustment of search parameters (e.g. Smith-Waterman Gap values) influences % Query Match value

  26. Types of Nucleotide Sequence Searching • Standard Search (cDNA) • Oligomer • finds database hits with longest regions of matching residues – mismatches not tolerated in region of hit match • Length Limited Oligomer • returns database hits within requested length range • mismatches not tolerated in region of hit match • Score Over Length – finds mismatched sequence database hits based on requested length and identity range

  27. Why doesn’t a standard search of the cDNA provide an adequate search of fragments? • Long length sequence hits with many matches and mismatches score higher and appear first on the hit list, compared to short sequences having high correspondence • lots of regional local similarity in a long sequence scores higher than a 10-mer with 100% identity • Consequence • small sequences, of 100% identity or less, are buried tens of thousands of hits down the hit list • most small sequence hits effectively lost • especially for hits with <100% correspondence

  28. Why doesn’t a standard search of the cDNA provide an adequate search of fragments? • Fragments and types of sequence searches • Standard Search (cDNA): fragment hits buried • oligomer: fragment hits buried • searching multiple fragments: millions of hits and alignments to consider • Each fragment of a specified sequence and length requires a separate search

  29. Standard Oligomer Searching • Won’t provide thorough search of fragments since longer hits score higher on hit table • Smaller size hits lost, effectively not seen • Does not tolerate mismatches in region of matches • Consequently inefficient means of finding small sequences, and with <100% in correspondence • Better suited to finding long sequences

  30. Length Limited Oligomer Searching • Sequence request needs to set size limit consistent with the size range being claimed • Does not tolerate mismatches in region of matches • Consequently inefficient means of finding small sequences with <100% in correspondence • Better suited to finding small sequences with 100% correspondence

  31. Score Over Length Searching • Small oligos with <100% correspondence • within requested length and identity (>60%) range • Manual manipulation of first 65,000 hits • necessitates 2+ additional hrs. of searcher’s time • does not include computer search time • Calculation • Hit Scoredivided byHit Length • for first 65,000 hits of table • Hits then sorted by Score/Length value • First 65,000 hits likely to contain small length sequence hits down to 60% identity

  32. Searching Small Sequences: Example Consider the following claim: • An oligonucleotide consisting of 8 to 20 nucleotides which specifically hybridizes to a nucleic acid coding for mud loach growth hormone (Seq. Id. No. X). • The specification teaches that oligonucleotides which specifically hybridize need not have 100% sequence correspondence.

  33. Mud Loach Growth Hormone cDNA • 670 nucleotides long • 630 nucleotides in the coding region • 210 amino acids

  34. Standard Search GenBank Hit Table Against cDNA

  35. Standard Search GenBank Hit Table Against cDNA

  36. Standard Search GenBank Alignments Against cDNA

  37. Standard Search GenBank Alignments Against cDNA

  38. Oligomer Search GenBank Hit Table Against cDNA

  39. Oligomer Search GenBank Hit Table Against cDNA

  40. Oligomer Search GenBank Alignments Against cDNA

  41. Oligomer Search GenBank Alignments Against cDNA

  42. Length-Limited (8 to 20) Oligomer Search GenBank Hit Table cDNA

  43. Length-Limited (8 to 20) Oligomer Search GenBank Hit Table cDNA

  44. Length-Limited (8 to 20) Oligomer Search GenBank Alignments cDNA

  45. Score/Length GenBank Hit Table Against cDNA: 8-20-mers down to 80%

  46. Score/Length GenBank Hit Table Against cDNA: 8-20-mers down to 80%

  47. Score/Length Alignments Against cDNA: 8-20-mers down to 80%

  48. Score/Length Alignments Against cDNA: 8-20-mers down to 80%

  49. QUESTIONS? Michael P. Woodward Supervisory Patent Examiner - Art Unit 1631 571 272 0722 michael.woodward@uspto.gov John L. LeGuyader Supervisory Patent Examiner - Art Unit 1635 571 272 0760 john.leguyader@uspto.gov

More Related