benny
Uploaded by
23 SLIDES
507 VUES
240LIKES

Biomolecules

DESCRIPTION

Biomolecules. Nucleic acids. Nucleic acids. Are the genetic materials of all organisms and determine inherited characteristics. The are two kinds of nucleic acids, DNA & RNA.

1 / 23

Télécharger la présentation

Biomolecules

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Biomolecules Nucleic acids

  2. Nucleic acids • Are the genetic materials of all organisms and determine inherited characteristics. • The are two kinds of nucleic acids, DNA & RNA. • DNA is found in genes which are on chromosomes and carries ‘instructions’ for assembly of specific proteins. RNA is also involved in this process (transcription and translation). We will study this in UNIT4.

  3. DNA • All life on Earth has a common thread at the molecular level – DNA { deoxyribonucleic acid} • DNA is a large (macro) molecule made up of a series of chemical building blocks called nucleotides. • A nucleotide is composed of a phosphate group, sugar and a nitrogen containing base. • DNA is organised into segments called GENES • In these genes are triplets called ‘codons’ that translate the nucleotide sequences into amino acids (protein)

  4. Each NUCLEOTIDE is made of: • A phosphate group • A 5 carbon sugar (deoxyribose), • [ in any nucleotide a phosphate is attached to the 5’ carbon and the base to the 1’ carbon] • One of the 4 bases (A,G,C,T) Nucleotides join together to form a polynucleotide chain. The two ends of the chain are different and are referred to as the 5’ & 3’. This makes the DNA double helix ‘antiparallel’.

  5. Complementary Base Pairs • The 4 nitrogenous bases are: • Adenine (A) - Purine type double ring structure • Guanine (G) - Purine type double ring structure • Thymine (T) - Pyrimidine type single ring structure • Cytosine (C) - Pyrimidine type single ring structure • Of these bases only A can bond to T and only G can bond to C

  6. DNA Structure DNA may exist as a double-stranded helix. Each strand is a polynucleotide. Each nucleotide is made up of a deoxyribose sugar, a purine or pyrimidine base and a phosphate group.

  7. Phosphate: Links neighboring sugars Sugar: One of two types possible: ribose in RNA and deoxyribose in DNA Base: Four types are possible in DNA: adenine, guanine, cytosine and thymine. RNA has the same except uracil replaces thymine. Structure of Nucleotides • The chemical structure of nucleotides: Symbolic form

  8. Phosphate Base Nucleotides • The building blocks of nucleic acids (DNA and RNA) comprise the following components: • a sugar (ribose or deoxyribose) • a phosphategroup • a base (four types for each of DNA and RNA) Adenine Sugar

  9. DNA & RNA Compared • Structural differences between DNA and RNA include:

  10. Base component of a nucleotide Nucleotide Bases • The base component of nucleotides which comprise the genetic code. Always pair up with purines

  11. Double strand formation This occurs because of H-bonding between the base pairs as follows: Note number of H-bonds between each base pair.

  12. Watson and Crick double helix: B type

  13. Watson and Crick double helix: B type

  14. The central DOGMA of Molecular Biology can be summarised in the form:

  15. RNA (ribonucleic acid) • RNA is a single nucleotide chain, similar to DNA (double chain), but with the sugar ribose in place of deoxyribose and uracil (U) rather than thymine (T). • The bases G, C, T and A in DNA are transcribed respectively as C, G A and U in RNA. • There are three main forms of RNA: ribosomal(rRNA), messenger (mRNA) and transfer RNA (tRNA).

  16. Synthesis of Proteins How are such a diverse range of proteins possible? The code for making a protein is found in your genes (on your DNA). This genetic code is copied onto a messenger RNA molecule. The mRNA code is read in multiples of 3 (a codon) by ribosomes which join amino acids together to form a polypeptide. This is known as gene expression.

  17. M S F T L K E G G E S G G G M E E E L L L T T T F F F S K M G K F T L S E K S T G A C T A G E G M S K S S G G M G G M K E E K K T M M T T G F G F F G G L E L L E E E E AUGAGUAAAGGAGAAGAACUUUUCACUGGAUA E E S G K G M E E L T F The protein folds to form its working shape Gene Expression Gene DNA Cell machinery copies the code making an mRNA molecule. This moves into the cytoplasm. Ribosomes read the code and accurately join Amino acids together to make a protein CELL The order of bases in DNA is a code for making proteins. The code is read in groups of three NUCLEUS Chromosome S K G E M F E G L T

  18. Proteomics • Proteomics is the study of the proteome. • The proteome is the entire complement of proteins expressed by a genome, cell, tissue or organism. • More specifically, it is the expressed proteins at a given time point under defined conditions. • The term is a blend of proteins and genome.

  19. A cellular proteome is the collection of proteins found in a particular cell type under a particular set of environmental conditions such as exposure to hormone stimulation. • It can also be useful to consider an organism's complete proteome, which can be conceptualized as the complete set of proteins from all of the various cellular proteomes. This is very roughly the protein equivalent of the genome.

  20. Proteome • The term "proteome" has also been used to refer to the collection of proteins in certain sub-cellular biological systems. For example, all of the proteins in a virus can be called a viral proteome. • The proteome is larger than the genome, especially in eukaryotes, in the sense that there are more proteins than genes.

More Related