benoit
Uploaded by
35 SLIDES
2644 VUES
890LIKES

Introduction to Phylogenetics

DESCRIPTION

Introduction to Phylogenetics . Phylogenetics . Phylogenetics is the study of evolutionary relationships among a group of organisms. Phylogenetic analysis is the means of inferring or estimating these relationships.

1 / 35

Télécharger la présentation

Introduction to Phylogenetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Introduction to Phylogenetics

  2. Phylogenetics • Phylogenetics is the study of evolutionary relationships among a group of organisms. • Phylogenetic analysis is the means of inferring or estimating these relationships. • The result of phylogenetic studies is a hypothesis about the evolutionary history of taxonomic groups: their phylogeny

  3. Human Mouse Rat Frog Fugu Tetraodon Zebrafish Phylogenetic tree • The evolutionary history inferred from phylogenetic analysis is usually depicted as branching, treelike diagrams that represent an estimated pedigree of the inherited relationships among molecules (‘‘gene trees’’), organisms, or both. Species tree

  4. Why phylogenetic trees? • Phylogenetic trees are extremely handy tools used by biologists to understand: - the composition of genomes, - relationships among genes in humans and other species, - the functions of proteins that run our cells, - historical relationships among diverse species, - the processes that generate unique body shapes, - the origins of remarkable abilities in living organisms,

  5. Types of trees Rooted trees reflect the most basal ancestor of the tree in question Unrooted trees do not imply a known ancestral root.

  6. Terminologies Nucleotide substitution or amino acid substitution Internal branch Node (common ancestors, hypothetical) Leaf/operational taxonomic units (OTUs) Root External branch outgroup

  7. Terminologies Nodes: represent taxonomic units. Internal nodes correspond to ancestral species that are not part of the data. Internal branch: between 2 nodes. Internal nodes are connected by internal branches. External branch: between a node and a leaf (OTUs). Leaves are connected to the rest of the tree by the external branches emanating from an internal node. Leaf/operational taxonomic units (OTUs): The observed species (corresponding to the data) appear at the tip of the branches. Species/genes/population. Horizantal branch length: Thebranch lenght usually represents the number of changes that have occured in that branch.

  8. Outgroup: Is a taxon that is clearly more distantly related to the taxa of interest than any of them is to another of these taxa. Tree topology: The branching pattern of a tree is called the topology. Clade: A set of all taxa derived from particular common ancestor. Cladogenesis: The process of branching. Unscaled trees: Branch lengths are not proportional to the number of changes. Scaled trees: Branch lengths are proportional to the number of changes

  9. A B A B D C C D B A C D A C C A B B D D Altering the position of root, changes the meaning of Phylogenetic tree A C D B C and D branch late C and D branch early

  10. Changing the taxon order doesn't matter

  11. Types of trees Simply shows relative recency of common ancestor A cladogram with branch lengths A dendogram having all tips equidistant from root

  12. Types of Phylogenetic Data • Biomolecular sequences: DNA, RNA, amino acid, in a multiple alignment • Molecular markers (e.g., SNPs, RFLPs, etc.) • Morphology • Gene order and content

  13. Molecular Data There are two types of molecular data: characters and distances Characters: can be a nucleotide / amino acid at a site in DNA /protein sequence, or the presence or absence of deletion or insertion at a site. That is each nucleotide/amino acid site in a DNA/protein sequence can be consider a character site. Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA Species C TTCACTAGACCT--TGGTCCA Species D TTGACCAGACCT--TGGTCCG Species E TTGACCAGTTCT-- TAGTTCG

  14. Making trees using character-based methods The main idea of character based methods is to search for a tree that requires the smallest number of evolutionary changes to explain the differences among the OTUs under study. Such a tree is called maximum parsimonious (“simple”) tree.

  15. As an example of tree-building using maximum parsimony, consider these four taxa: AAG AAA GGA AGA How might they have evolved from a common ancestor such as AAA?

  16. Tree-building methods: Maximum parsimony

  17. Molecular Data Distance:the other type of data are distance data, which are computed from DNA or amino acid sequence data . These data are also called the distance matrix data, because the distance are usually presented in the matrix from.

  18. Tree construction using distances

  19. The simplest distance based method is UPGMA • UPGMA employs a sequential clustring algorithm, in which local topological relationships are inferred in order of decreasing similarity and a phylogenetic tree is built in a stepwise manner. • First we identify the two OTUs that are most similar to each other (having the shortest distance) and treat them as a new single OTU. • Such an OTU is is referred to as a composite OTU. • Subsequently from among the new group of OTUs, we identify the pair with the highest similarity and so on, until only two OTUs are left.

  20. UPGMA

  21. OTU 1 2 3 d12 2 3 d13 d23 d14 d34 4 d24 UPGMA Consider a case of four OTUs. The pairwise evolutionary distances are given by the following matrix:

  22. UPGMA: Construct a phylogenetic tree following UPGMA algorithm.

  23. Distance Matrix

  24. TRY THIS!!!

  25. Neighbor joining Method Neighbor-joining (Saitou and Nei, 1987) is a method that is related to the cluster method but does not require the data to be ultrametric. In other words it does not require that all lineages have diverged by equal amounts. The method is especially suited for datasets comprising lineages with largely varying rates of evolution.

  26. Neighbor joining Method The neighbor-joining method Is especially useful for making a tree having a large number of taxa. Begin by placing all the taxa in a star-like structure.

  27. Compute pairwise distances among all OTUs. • Retain the pair with smallest distance (neighbors). Group i and j in the tree. Connect these neighbors to other OTUs via an internal branch, XY. • When two nodes are linked, their common ancestral node is added to the tree and the terminal nodes with their respective branches are removed from the tree.

  28. Neighbor joining Method N=6 N=4 N=5

  29. Applications of phylogeny "Species" trees recover the genealogy of taxa, individuals of a population, etc. Internal nodes represent speciation or other taxonomic events. Species trees should contain sequences from only orthologous genes.

  30. "Gene" trees represent the evolutionary history of the genes included in the study. Gene trees can provide evidence for gene duplication events, as well as speciation events. Sequences from different homologs can be included in a gene tree; the subsequent analyses should cluster orthologs, thus demonstrating the evolutionary history of the orthologs.

  31. Tools/Softwares • CLUSTALW http://www.ebi.ac.uk/Tools/services/web/toolform.ebi?tool=clustalw2 • PHYLIP http://evolution.genetics.washington.edu/phylip.html • PAUP http://paup.csit.fsu.edu/ • Mega5 • http://www.ncbi.nlm.nih.gov/pubmed/21546353

More Related