1 / 23

Pattern Formation in Synthetic Bacterial Colonies

Pattern Formation in Synthetic Bacterial Colonies. Fran Romero and Karima Righetti Research Fellow School of Computer Science University of Nottingham. Nottingham 18th of March 2010. Outline.

bertha
Télécharger la présentation

Pattern Formation in Synthetic Bacterial Colonies

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Pattern Formation in Synthetic Bacterial Colonies Fran Romero and Karima Righetti Research Fellow School of Computer Science University of Nottingham Nottingham 18th of March 2010

  2. Outline • A modelling language for the incremental and parsimonious design of synthetic gene circuits in multicellular systems. • Design of a gene circuit producing the emergence of pattern formation in synthetic bacterial colonies. • Implementation of our synthetic gene circuit in bacterial colonies of Escherichia coli. Pattern Formation in Synthetic Bacterial Colonies

  3. Outline • A modelling language for the incremental and parsimonious design of synthetic gene circuits in multicellular systems. • Design of a gene circuit producing the emergence of pattern formation in synthetic bacterial colonies. • Implementation of our synthetic gene circuit in bacterial colonies of Escherichia coli. Pattern Formation in Synthetic Bacterial Colonies

  4. Top-Down Synthetic Biology: An Approach to Engineering Biology • Cells are information processors. DNA is their programming language. • DNA sequencing and PCR: Identification and isolation of cellular parts. • Recombinant DNA and DNA synthesis : Combination of DNA and construction of new systems. • Tools to make biology easier to engineer:Standardisation, encapsulation and abstraction (blueprints). Pseudomonas aeruginosa Discosoma sp. Aequorea victoria Vibriofischeri E. coli plasmids Chassis DNA synthesis Circuit Blueprint Pattern Formation in Synthetic Bacterial Colonies

  5. Characterisation/Encapsulation of Cellular Parts: Gene Promoters AHL • A modeling language for the design of synthetic bacterial colonies. • A module, set of rules describing the molecular interactions involving a cellular part, provides encapsulation and abstraction. • Collection or libraries of reusable cellular parts and reusable models. LuxR CI 01101110100001010100011110001011101010100011010100 PluxOR1({X},{c1, c2, c3, c4, c5, c6, c7, c8, c9},{l}) = { type: promoter sequence: ACCTGTAGGATCGTACAGGTTTACGCAAGAA ATGGTTTGTATAGTCGAATACCTCTGGCGGTGATA rules: r1: [ LuxR2 + PluxPR.X ]_l -c1-> [ PluxPR.LuxR2.X ]_l r2: [ PluxPR.LuxR2.X ]_l -c2-> [ LuxR2 + PluxPR.X ]_l ... r5: [ CI2 + PluxPR.X ]_l -c5-> [ PluxPR.CI2.X ]_l r6: [ PluxPR.CI2.X ]_l -c6-> [ CI2 + PluxPR.X ]_l ... r9: [ PluxPR.LuxR2.X ]_l -c9-> [ PluxPR.LuxR2.X + RNAP.X ]_l } Pattern Formation in Synthetic Bacterial Colonies

  6. Module Variables: Recombinant DNA, Directed Evolution, Chassis selection • Recombinant DNA: Objects variables can be instantiated with the name of specific genes. PluxOR1({X=tetR}) PluxOR1({X=GFP}) • Directed evolution: Variables for stochastic constantscan be instantiated with specific values. A PluxOR1({X=GFP},{...,c4=10,...}) • Chassis Selection: The variable for the labelcan be instantiated with the name of a chassis. PluxOR1({X=GFP},{...,c4=10,...},{l=DH5α }) Pattern Formation in Synthetic Bacterial Colonies

  7. Characterisation/Encapsulation of Cellular Parts: Riboswitches • A riboswitch is a piece of RNA that folds in different ways depending on the presence of absence of specific molecules regulating translation. ToppRibo({X},{c1, c2, c3, c4, c5, c6},{l}) = { type: riboswitch sequence:GGTGATACCAGCATCGTCTTGATGCCCTTGG CAGCACCCCGCTGCAAGACAACAAGATG rules: r1: [ RNAP.ToppRibo.X ]_l -c1-> [ ToppRibo.X ]_l r2: [ ToppRibo.X ]_l -c2-> [ ]_l r3: [ ToppRibo.X + theop ]_l –c3-> [ ToppRibo*.X ]_l r4: [ ToppRibo*.X ]_l –c4-> [ ToppRibo.X + theop ]_l r5: [ ToppRibo*.X ]_l –c5-> [ ]_l r6: [ ToppRibo*.X ]_l –c6-> [ToppRibo*.X + Rib.X ]_l } Pattern Formation in Synthetic Bacterial Colonies

  8. Characterisation/Encapsulation of Cellular Parts: Degradation Tags • Degradation tags are amino acid sequences recognised by proteases. Once the corresponding DNA sequence is fused to a gene the half life of the protein is reduced considerably. degLVA({X},{c1, c2},{l}) = { type: degradation tag sequence: CAGCAAACGACGAAAACTACGCTTTAGTAGCT rules: r1: [ Rib.X.degLVA ]_l -c1-> [ X.degLVA ]_l r2: [ X.degLVA ]_l -c2-> [ ]_l }

  9. Higher Order Modules: Building Synthetic Gene Circuits PluxOR1 ToppRibo geneX degLVA 3OC6_repressible_sensor({X}) = { PluxOR1({X=ToppRibo.geneX.degLVA},{...},{l=DH5α}) ToppRibo({X=geneX.degLVA},{...},{l=DH5α}) degLVA({X},{...},{l=DH5α}) } X=GFP Plux({X=ToppRibo.geneCI.degLVA},{...},{l=DH5α}) ToppRibo({X=geneCI.degLVA},{...},{l=DH5α}) degLVA({CI},{...},{l=DH5α}) PtetR({X=ToppRibo.geneLuxR.degLVA},{...},{l=DH5α}) Weiss_RBS({X=LuxR},{...},{l=DH5α}) Deg({X=LuxR},{...},{l=DH5α}) ACCTGTAGGATCGTACAGGTTTACGCAAGAAATGGTTTGTATAGTCGAATACCTCTGGCGGTGATAGGTGATACCAGCATCGTCTTGATGCCCTTGGCAGCACCCCGCTGCAAGACAACAAGATG GTG .... GCAGCAAACGACGAAAACTACGCTTTAGTAGCT

  10. Specification of Single Cells: P systems • Abstraction of the structure and functioninga single cell. • Compartmental models • Rule-based modelling approach • Discrete and stochastic semantics Objects Membranes Rewriting Rules Pattern Formation in Synthetic Bacterial Colonies

  11. Specification of Multi-cellular Systems: LPP systems AHL AHL AHL GFP LuxR PluxOR1 Pconst luxR gfp LuxI AHL luxI CI Pconst Plux cI Pattern Formation in Synthetic Bacterial Colonies

  12. Specification of Multi-cellular Systems: LPP systems AHL AHL AHL GFP LuxR PluxOR1 Pconst luxR gfp LuxI AHL luxI CI Pconst Plux cI Pattern Formation in Synthetic Bacterial Colonies

  13. Infobiotics: An Integrated Framework http://www.infobiotics.org/infobiotics-workbench/ Cellular Parts Synthetic Circuits Single Cells Synthetic Multi-cellular Systems Libraries of Modules Module Combinations P systems LPP systems A compiler based on a BNF grammar Multi Compartmental Stochastic Simulations based on Gillespie’s algorithm Spatio-temporal Dynamics Analysis using Model Checking with PRISM and MC2 Automatic Design of Synthetic Gene Regulatory Circuits using Evolutionary Algorithms Pattern Formation in Synthetic Bacterial Colonies

  14. Outline • A modelling language for the incremental and parsimonious design of synthetic gene circuits in multicellular systems. • Design of a gene circuit producing the emergence of pattern formation in synthetic bacterial colonies. • Implementation of our synthetic gene circuit in bacterial colonies of Escherichia coli. Pattern Formation in Synthetic Bacterial Colonies

  15. Synthetic Biology: Learning by building • Validation of hypothesis about the functioning of cellular systems by implementing them in vivo. • Specific pattern formation in several organisms is produced by transcriptional networks with a double negative feedback loop at their core. Pattern Formation in Synthetic Bacterial Colonies

  16. Synthetic Double Negative Feedback Loop AmeR 3OC6 LuxR ameR lacI cherry luxR luxI PLtet01 Plux,R PameABC LacI C4 TetR rhlR arpR tetR gfp rhlI Ptac PrhlA ParpABC RhlR ArpR Pattern Formation in Synthetic Bacterial Colonies

  17. AmeR LuxR ameR lacI cherry luxR luxI PLtet01 Plux,R PameABC LacI C4 rhlR arpR tetR gfp rhlI Ptac PrhlA ParpABC RhlR ArpR 3OC6 C4 C4 Pattern Formation in Synthetic Bacterial Colonies

  18. AmeR 3OC6 LuxR ameR lacI cherry luxR luxI PLtet01 Plux,R PameABC TetR rhlR arpR tetR gfp rhlI Ptac PrhlA ParpABC RhlR ArpR 3OC6 3OC6 3OC6 C4 C4 C4 C4 3OC6 3OC6 Pattern Formation in Synthetic Bacterial Colonies

  19. Pattern Formation in synthetic bacterial colonies Pattern Formation in Synthetic Bacterial Colonies

  20. Pattern Formation in synthetic bacterial colonies Pattern Formation in Synthetic Bacterial Colonies

  21. Potential Issues • Leakiness in some genes. • Unintended interactions. Pattern Formation in Synthetic Bacterial Colonies

  22. Outline • A modelling language for the incremental and parsimonious design of synthetic gene circuits in multicellular systems. • Design of a gene circuit producing the emergence of pattern formation in synthetic bacterial colonies. • Implementation of our synthetic gene circuit in bacterial colonies of Escherichia coli. Pattern Formation in Synthetic Bacterial Colonies

  23. TAKE HOME MESSAGE • Development of a synergy between gene circuit design/modelling and wet lab implementation. • Development of a modelling language close to the lab protocols. • Development of wide library of molecular parts/modules from different organisms. • Application of novel techniques for controlling synthetically gene networks. Pattern Formation in Synthetic Bacterial Colonies

More Related