Uploaded by brittania

22 SLIDES

439 VUES

230LIKES

Rev. -, 11

DESCRIPTION

Rev. -, 11/17/10, TAD. 2. AgendaWhat Is ITAR?Why Do We Care About ITAR? DefinitionsFundamental Research ExemptionPublic DomainDeemed ExportUS PersonsComplianceMeetings w/ ITAR InformationMeans of Transferring InformationVerbal InformationManaging ITAR Paper DocumentsManaging ITAR Electr

Rev. -, 11

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

1. Rev. -, 11/17/10, TAD 1

IDX Xeptors Training Presentation Rev. 11/04

IDX Xeptors Training Presentation Rev. 11/04. Its All About Security: Crossplay Counterfeits. What Is This Training For?. To Understand Crossplay &amp; Counterfeiting Issues. To Know How To Setup &amp; Operate IDX Xeptors To Successfully Defeat Crossplay &amp; Counterfeiting.

743 views • 53 slides

Body Tissues rev 9-11

Body Tissues rev 9-11 Tissue : group of cells that are similar in structure and perform a common function 4 primary tissue groups Epithelial Connective Muscle Nervous Epithelial Tissue sheet of cells that covers a body surface or lines a body cavity;

595 views • 39 slides

Body Terminology rev 9-11 Lab 1

Body Terminology rev 9-11 Lab 1. Begins on page 14 in Manual Need to know terms in bold print throughout Exercise 3 Body Planes Frontal --divides the body into anterior and posterior halves (the front half and the back half) Sagittal --divides the body into right and left halves.

277 views • 17 slides

Rev. 4:6b-11

126 views • 4 slides

Rev. 11/5/13

Scorer Clinic. TONY HILL. USAV NATIONAL OFFICIAL. USAV NATIONAL SCORER. Rev. 11/5/13. R1. L1. L3. Team Bench. Team Bench. Officials and Work Team Common Placement. R1 – 1 st Referee R2 – 2 nd Referee S – Scorer

952 views • 55 slides

P-REV

P-REV. Michael Connaboy Stephen Schiffli Ram Hudiara Win Than Aung. Safety and Reliability Issues. Safety Issues Traction control failure Uncontrolled Acceleration Reliability issues Interference with wireless data transmission Noise from motors causing interference with circuitry.

213 views • 8 slides

Smyrna (Rev 2:8-11)

Smyrna (Rev 2:8-11). November 4, 2012. Seven Elements To Each Letter. Name of the church Title of Christ chosen Commendation given Concerns expressed Exhortation Promise to the overcomer Closing - “He that hath an ear…”. Levels of Application. Local churches (real congregations)

912 views • 19 slides

Rev. 10:1-11 (NRSV)

167 views • 4 slides

The Urinary System rev 4/11

The Urinary System rev 4/11. Excretion refers to the processes that remove wastes and excess materials from the body. Urinary system has primary responsibility for homeostasis of water and most solutes in blood and other body fluids. Urine is essentially water and solutes.

480 views • 24 slides

Nervous System I Lab 5 ( rev 3-11)

Nervous System I Lab 5 ( rev 3-11). The CNS consists of the brain and spinal cord is the integrating and command center of the nervous system it interprets incoming sensory information and produces motor responses.

409 views • 33 slides

Fr. Rev.

Fr. Rev. Jeopardy!. Fr. Rev. Jeopardy. 100. 100. 100. 100. 100. 200. 200. 200. 200. 200. 300. 300. 300. 300. 300. 400. 400. 400. 400. 400. 500. 500. 500. 500. 500. FINAL. The King and Queen in 1789. Monarchy 100. Louis XVI &amp; Marie Antoinette.

499 views • 29 slides

The Respiratory System rev 11-11

The Respiratory System rev 11-11. The primary function of the respiratory system is to deliver oxygen (O 2 ) to and remove carbon dioxide (CO 2 ) from the blood. The respiratory system also plays a role in maintaining the blood pH (acid-base balance).

452 views • 23 slides

- Rev

A. D4. A. pA. SV40. SV-SD4/RRE/SA-pA. RRE. SA5. BPS 1. A4c. BPS 2. A4a. A4b. PPy. PPy. *. *. *. *. *. AAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATGACAAAAGCCTTAGGCATCTCCTATGGC AG. SA5. AAAAAGTGTTGCTTTCATTGCCA C GTTTGTTTCATGACAAA C GCCTT C GG CATCTCCTATGGC AG. SA5 AG -.

148 views • 1 slides

Rev. 7/11/03

Rev. 7/11/03. WOMEN’S RECRUITING INITIATIVE 2003-2004. 1987 International Convention Constitutional Amendment. OFFICIAL NOTICE The following proposed amendment will be reported to the delegates for vote at the 1987 International Convention: CONSTITUTION

456 views • 35 slides

The Heart and General Circulation rev 6-11

The Heart and General Circulation rev 6-11. The heart and blood vessels are collectively known as the cardiovascular system The heart is a hollow muscular organ whose contractions creates the force and pressure which moves blood throughout our body The heart is a pump

482 views • 25 slides

Cell Facts rev 9-11

Cell Facts rev 9-11. Cells are the basic structural and functional units of life The activity of an organism depends on the activity of its cells The biochemical activities of a cell are dictated by its organelles The continuity of life has a cellular basis-

584 views • 36 slides

The Immune System (rev 11/11)

The Immune System (rev 11/11). Defense mechanisms keep us healthy Physical and chemical barriers i.e. skin, stomach acids Prevent many harmful substances from entering the body and kill many that successfully entered

802 views • 72 slides

Cultural Rev

Started in 1966 Restored Mao to undisputed authority The Little Red Book Rivals were purged Early 1970’s they are restored to power By 1976, Mao consolidated the CCP and established better relations with USA and recover a seat in UN for China. Cultural Rev.

233 views • 13 slides

Rev 10.0

Rev 10.0. RamDisk 2000/XP/2003 SuperSpeed 2000/XP/2003 SuperCache 2000/2003. Super Performance RamDisk and Disk Caching Software for Windows 2000, Windows XP, and Windows Server 2003. Leaders in disk caching &amp; RAM disk technology for Windows XP, Windows Server 2003, Windows 2000,

505 views • 30 slides

4/11 Rev 0 Marketing - Muncie

Ultra Low Emissions Burner. 4/11 Rev 0 Marketing - Muncie. Agenda. Who is Maxon? XPO ™ Introduction Benefits of XPO ™ Why select XPO for your indirect fire needs?. XPO ™ Introduction.

307 views • 15 slides

AX84 P1 Rev. 11 A Successful Layout

AX84 P1 Rev. 11 A Successful Layout. The following three slides show how I laid out my P1. I used standard parts like a Hammond 125E output transformer and RatShack terminal strips. The power transformer came from my father’s old collection.

297 views • 4 slides

4/11 Rev 0 Marketing - Muncie

Ultra Low Emissions Burner. 4/11 Rev 0 Marketing - Muncie. Agenda. Who is Maxon? XPO ™ Introduction Benefits of XPO ™ Why select XPO for your indirect fire needs?. XPO ™ Introduction.

171 views • 15 slides

More Related