Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Welcome to Introduction to Bioinformatics Friday, 12 September PowerPoint Presentation
Download Presentation
Welcome to Introduction to Bioinformatics Friday, 12 September

Welcome to Introduction to Bioinformatics Friday, 12 September

88 Vues Download Presentation
Télécharger la présentation

Welcome to Introduction to Bioinformatics Friday, 12 September

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Welcome toIntroduction to BioinformaticsFriday, 12 September Introduction to Scenario 2 Finding biologically important sites in DNA How to avoid being fooled by imposters? Scenario 1: Genomic comparisons Problem Sets 1M and 1P

  2. Scenario 2 Finding biologically important sites in DNA

  3. You: A typical grad student

  4. You: A typical grad student

  5. Your object of study: Cyanobacteria

  6. Critical position in food web CO2 sugarN2 ammoniaH2O electrons Your object of study: Cyanobacteria How do they do it?

  7. heterocysts sucrose N2 fixation in cyanobacteria N2 CO2 O2 Matveyev and Elhai (unpublished)

  8. heterocysts sucrose NH3 N2 fixation in cyanobacteria NH3 N2 O2 CO2 Matveyev and Elhai (unpublished)

  9. Differentiation in cyanobacteria -NH3 ? ? ? ? ? Heterocysts

  10. Response to environment How do bacteria respond to the environment? From gene to protein DNA RNA protein

  11. How do bacteria respond to the environment? From gene to protein RNAPol DNA P RNA protein

  12. NH3 glutamine α-ketoglutarate How do cyanobacteria respond to NH3? From gene to protein High N Low N DNA binding protein, NtcA RNAPol DNA Binding site P No RNA

  13. NH3 glutamine α-ketoglutarate How do cyanobacteria respond to NH3? From gene to protein High N Low N DNA binding protein, NtcA RNAPol DNA Binding site P No RNA

  14. RNA protein How do cyanobacteria respond to NH3? From gene to protein Low N RNAPol NtcA DNA Binding site P α-ketoglutarate

  15. Differentiation in cyanobacteria -NH3 ? ? ? ? ? Heterocysts

  16. Differentiation in cyanobacteria -NH3 Activates NtcA (Nitrogen Control) ? ? ? Heterocysts

  17. mRNA GTA…(8)…TAC …(20-24)…TAnnnT Differentiation in cyanobacteriaWhat does NtcA bind to? Herrero et al (2001) J Bacteriol 183:411-425

  18. HetQ -N NtcA ??? Position in cell cycle Level of PatS Level of HetN Differentiation in cyanobacteriaIntegration of signals through HetR Genes needed for differentiation HetR Master regulator StrategyPCR out hetQRandom mutagenesisLook for effects on HetR expression/activity

  19. Differentiation in cyanobacteriaFind primers to PCR out hetQ cctatctccgccctatggcgatttgggcaatatatttgatgattggttag ...hypothetical ttgtcagttgtcagacgtagtagcgcgtctagtctaatgtgttgttatat protein tatttgctactagaaatgaggagagggttatttttctcactgcttcccaa ttctatgagaatataaaattttccttaagtttctcatggcaataatggaa aaaaccgaccattctgatgaataagtccggttttttccaaaaaatatttt tgctttttcgctttatttatctatatttccaagttttagtacatcggtga ggggtgacaactatcttgccaatattgtcgttattgttaggttgctatcg gaaaaaatctgtaacatgagatacacaatagcatttatatttgctttagt atctctctcttgggtgggattctgcctgcaatttaaaaaccagtgttaac aattttcggctttattttccgggagttaaatcaaccaagggaaaatgtaa ctaatgtttaaatatcttcggatacacacaaagtaaaaccaatttttaca gatgtcgatgttgctcacattttttagaaatattactaaattaaaaatgt tattaaatttatgttcatagagaaccttttccaaataaaaaaataatttt cctgatgttttaagaaaattactgttgttataaattaaaggtgattcaac aaaatatagatagttctttcaataactatctacttttaccattaagtgaa cttactcatgaataatcaacaggaattaaaaataaagttcatgaatactg gttaaagattcagtaaagtttgaggaaataccggaataaatttccaccca aatatgattttttaaaagatacattggcagtacattaaaatgccgatgtt agataaatttgccttcatagctgttatctatttgctcagaactaagccaa gagtttacacaccaaacagaaattaaactatgaatccctcttcgtcgtta hetQ...

  20. Differentiation in cyanobacteriaFind primers to PCR out hetQ cctatctccgccctatggcgatttgggcaatatatttgatgattggttag ...hypothetical ttgtcagttgtcagacgtagtagcgcgtctagtctaatgtgttgttatatprotein tatttgctactagaaatgaggagagggttatttttctcactgcttcccaa ttctatgagaatataaaattttccttaagtttctcatggcaataatggaa aaaaccgaccattctgatgaataagtccggttttttccaaaaaatatttt tgctttttcgctttatttatctatatttccaagttttagtacatcggtga ggggtgacaactatcttgccaatattgtcgttattgttaggttgctatcg gaaaaaatctgtaacatgagatacacaatagcatttatatttgctttagt atctctctcttgggtgggattctgcctgcaatttaaaaaccagtgttaac aattttcggctttattttccgggagttaaatcaaccaagggaaaatgtaa ctaatgtttaaatatcttcggatacacacaaagtaaaaccaatttttaca gatgtcgatgttgctcacattttttagaaatattactaaattaaaaatgt tattaaatttatgttcatagagaaccttttccaaataaaaaaataatttt cctgatgttttaagaaaattactgttgttataaattaaaggtgattcaac aaaatatagatagttctttcaataactatctacttttaccattaagtgaa cttactcatgaataatcaacaggaattaaaaataaagttcatgaatactg gttaaagattcagtaaagtttgaggaaataccggaataaatttccaccca aatatgattttttaaaagatacattggcagtacattaaaatgccgatgtt agataaatttgccttcatagctgttatctatttgctcagaactaagccaa gagtttacacaccaaacagaaattaaactatgaatccctcttcgtcgtta hetQ...

  21. Differentiation in cyanobacteriaFind primers to PCR out hetC ttgtcagttgtcagacgtagtagcgcgtctagtctaatgtgttgttatat tatttgctactagaaatgaggagagggttatttttctcactgcttcccaa ttctatgagaatataaaattttccttaagtttctcatggcaataatggaa aaaaccgaccattctgatgaataagtccggttttttccaaaaaatatttt tgctttttcgctttatttatctatatttccaagttttagtacatcggtga ggggtgacaactatcttgccaatattgtcgttattgttaggttgctatcg gaaaaaatcTGTAacatgagaTACAcaatagcatttatatttgctttagt atctctctcttgggtgggattctgcctgcaatttaaaaaccagtgttaac aattttcggctttattttccgggagttaaatcaaccaagggaaaatgtaa ctaatgtttaaatatcttcggatacacacaaagtaaaaccaatttttaca gatgtcgatgttgctcacattttttagaaatattactaaattaaaaatgt tattaaatttatgttcatagagaaccttttccaaataaaaaaataatttt cctgatgttttaagaaaattactgttgttataaattaaaggtgattcaac aaaatatagatagttctttcaataactatctacttttaccattaagtgaa cttactcatgaataatcaacaggaattaaaaataaagttcatgaatactg gttaaagattcagtaaagtttgaggaaataccggaataaatttccaccca aatatgattttttaaaagatacattggcagtacattaaaatgccgatgtt agataaatttgccttcatagctgttatctatttgctcagaactaagccaa gagtttacacaccaaacagaaattaaactatgaatccctcttcgtcgtta hetC... GTA…(8)…TAC

  22. Differentiation in cyanobacteria ttctatgagaatataaaattttccttaagtttct aaaaccgaccattctgatgaataagtccggtttt tgctttttcgctttatttatctatatttccaagt ggggtgacaactatcttgccaatattgtcgttat gaaaaaatctGTAacatgagaTACacaatagcatttatatttgcttTAgtaTctctctcttgggtggg …(20-24)…TAnnnT GTA…(8)…TACNtcA binding site Promoter

  23. Differentiation in cyanobacteriaIntegration of signals through HetR HetQ -N NtcA ??? Genes needed for differentiation Position in cell cycle HetR Level of PatS Level of HetN Master regulator Stockholm

  24. How to proceed? • Choice #1 • Publish • Grant proposals • Build a career • Likely result • Reviewers trash MS: too speculative

  25. How to proceed? • Choice #2 • Forget about it • Back to PCR • Likely result • Sometimes miss spectacular finding

  26. How to proceed? • Choice #3 • Forget about PCR • Do backbreaking NtcA binding studies • Likely result • Might demonstrate binding of NtcA • Risky, may lose many months

  27. How to proceed? • Choice #4 • Determine whether site is likely to be real How? N! . . .a! (N-a)! • High school math approach

  28. How to proceed? • Choice #4 • Determine whether site is likely to be real How? BIOINFORMATICS • Simulation • Exhaustive pattern search

  29. End Scenario 2 Story Molecular Biology: Regulatory protein and binding sites Bioinformatics: Simulations; Nature of randomness Programming: Loops and arrays foreach $problem (@PS1M @PS1P){ if ($problem =~ /PS1[M-1|M-5|M-9|P-3|P-5]/){ Do_problem_now($problem); } } while ($time_permits);