1 / 30

Introduction to Computational Biology

Introduction to Computational Biology. Programming with Matlab. Why Program?. Programming a computer provides: Accuracy Reduce human error Speed and efficiency Processing the human genome manually is impossible Adding all numbers from 1..1000 is a waste of our time Repetition

callum-brooks
Télécharger la présentation

Introduction to Computational Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Introduction to Computational Biology Programming with Matlab

  2. Why Program? • Programming a computer provides: • Accuracy • Reduce human error • Speed and efficiency • Processing the human genome manually is impossible • Adding all numbers from 1..1000 is a waste of our time • Repetition • Same program can be run many times using different input data • Automation

  3. Anatomy of a program Input Instructions Output Data Steps encoded in a programming language Results – readable by you or another program 3, 4 Sum 7 Align GACACGTTTTTGG---TGGTTTT GAGCAGACACGTTTTTGGTGGTTTT |||| |||||| ||||||| GAGCAGACATTTTTTGATTCTGGTTTT GACAT-TTTTTGATTCTGGTTTT

  4. Computing • A computable task • Does it make sense to create a program to solve my problem? • Text Editor • A program that allows you to save text files • Emacs (unix), vi (unix), gedit (unix), notepad (Windows) • Compiler/Interpreter • gcc (C), javac (Java), perl (Perl)

  5. Strings “This is a string” ‘This is also a string’ “ACGACTACGACTAGCATCAGCATCAG”

  6. vectors >> v = [3 1] v = 3 1

  7. vectors >> v = [3 1]; >>

  8. Row vectors >> v = [3 1 7 -21 5 6] v = 3 1 7 -21 5 6

  9. column vectors >> v = [3 1 7 -21 5 6]' v = 3 1 7 -21 5 6

  10. A new vector >> v = [1:8] v = 1 2 3 4 5 6 7 8

  11. A new vector with increments of 0.25 >> v = [2:.25:4] v = Columns 1 through 7 2.0000 2.2500 2.5000 2.7500 3.0000 3.2500 3.5000 Columns 8 through 9 3.7500 4.0000

  12. Accessing vector elements >> v(1) ans = 2

  13. Basic operations >> v v = 0 2 4 6 8 >> v(1:3) ? >> v(2:4) ? >> v(1:3)-v(2:4) ans = -2 -2 -2

  14. Basic operations >> u = [0:-1:-4] u = 0 -1 -2 -3 -4 >> -2*u ans = 0 2 4 6 8

  15. A matrix: n x n (row x column) >> A = [ 1 2 3; 3 4 5; 6 7 8] A = 1 2 3 3 4 5 6 7 8

  16. Indexing a matrix A = 1 2 3 3 4 5 6 7 8 >> A(1:2,3:4) ??? Index exceeds matrix dimensions. >> A(1:2,2:3) ans = 2 3 4 5 >> A(1:2,2:3)' ans = 2 4 3 5

  17. Vector operations >> v+b ans = 3 6 9 >> v-b ans = -1 -2 -3 >> v = [1 2 3]' v = 1 2 3 >> b = [2 4 6]' b = 2 4 6

  18. Plotting >> v v = 1 2 3 >> b b = 2 4 6 >> plot(v,b)

  19. Loops >> for j=1:4, j end j = 1 j = 2 j = 3 j = 4

  20. Loops >> v = [1:3:10] v = 1 4 7 10 >> for j=1:4, v(j) = j; end >> v v = 1 2 3 4

  21. If statements a = 2; b = 3; if (a<b) j = -1; end

  22. If and elseif statements a = 4; b = 3; if (a<b) j = -1; else if (a>b) j = 2; end

  23. Character arrays >> c = ’atcg’

  24. http://www.math.ohiou.edu/~just/bioinfo05/supplements/MLBasicsIV/watson_crick.mhttp://www.math.ohiou.edu/~just/bioinfo05/supplements/MLBasicsIV/watson_crick.m Example 1: find the complement function c = watson_crick(v) %This is a function m-file for finding the Watson-Crick complement of a %string of nucleotide symbols % % %Author: Winfried Just % Department of Mathematics % Ohio University % Athens, OH 45701 % just@math.ohiou.edu % %Date: March 31, 2005 %Input: v - string of letters from the alphabet {a, c, g, t} %Output: c - the string of Watson-Crick complements to the terms of v %

  25. Example 1 cont. function c = watson_crick(v) for i = 1:length(v) if v(i) == 'a' c(i) = 't'; elseif v(i) == 'c' c(i) = 'g'; elseif v(i) == 'g' c(i) = 'c'; elseif v(i) == 't' c(i) = 'a'; else c(i) = '?'; disp('Non-nucleotide symbol encountered'); end end

  26. Run watson_crick >> watson_crick (’accgatgcttatggatc’)

  27. Example 2: find the AUG function start_codon(v) %This is a function m-file for finding the position of the first start codon % % %Author: Winfried Just % Department of Mathematics % Ohio University % Athens, OH 45701 % just@math.ohiou.edu % %Date: March 31, 2005 %Input: v - string of letters from the alphabet {a, c, g, t} %Output: a message that shows the position of the first % start codon in v %

  28. http://www.math.ohiou.edu/~just/bioinfo05/supplements/MLBasicsIV/start_codon.mhttp://www.math.ohiou.edu/~just/bioinfo05/supplements/MLBasicsIV/start_codon.m Example 2: find the AUG function start_codon(v) found = 0; %this variable will tell us when we have found a start codon i = 1; while ~found & i < length(v) - 1 if v(i) == 'a' & v(i+1) == 't' & v(i+2) == 'g' found = 1; disp(['start codon at position ', num2str(i)]) else i = i+1; end end if ~found disp('no start codon found') end

  29. Run start_codon >> start_codon(’accgatgcttatggatc’)

  30. Examples relevant to biology • Log-log plot • http://www.math.ohiou.edu/courses/matlab/math266a/266A-fitting-logplot.pdf

More Related