Manolis Kellis modENCODE analysis group January 11, 2007
Manolis Kellis modENCODE analysis group January 11, 2007. Part 1 : Target identification: comparative vs. exprmt. (really the topic for today) Part 2 : Target validation (optional) Part 3 : Motif discovery (optional) Part 4 : Enhancer identification (optional). Part 1.
Manolis Kellis modENCODE analysis group January 11, 2007
E N D
Presentation Transcript
Manolis KellismodENCODE analysis groupJanuary 11, 2007 Part 1: Target identification: comparative vs. exprmt. (really the topic for today) Part 2: Target validation (optional) Part 3: Motif discovery (optional) Part 4: Enhancer identification (optional)
Part 1 Identifying targets using comparative genomics
Evolutionary signatures of motif instances • Allow for motif movements • Sequencing/alignment errors • Loss, movement, divergence • Measure branch-length score • Sum evidence along branches • Close species little contribution BLS: 25% BLS: 83% Mef2:YTAWWWWTAR
Motif confidence selects functional instances Transcription factor motifs Confidence Confidence Increasing BLS Increasing confidence Confidence selects functional regions Confidence selects in vivo bound sites High sensitivity microRNA motifs Confidence selects positive strand Increasing BLS Increasing confidence Confidence selects functional regions
Initial regulatory network for an animal genome • ChIP-grade quality • Similar functional enrichment • High sens. High spec. • Systems-level • 81% of Transc. Factors • 86% of microRNAs • 8k + 2k targets • 46k connections • Lessons learned • Pre- and post- are correlated (hihi/lolo) • Regulators are heavily targeted, feedback loop
Network captures co-expression supported edges Red = co-expressed Grey = not co-expressed Named = literature-supported Bold = literature-supported 46% of edges are supported (P=10-3)
ChIP vs. conservation: similar power / complementary • Together: best complementary • Bound but not conserved: reduced enrichmnt Selects functional • All-ChIP vs. All-cons: similar enr. Similar power • Cons-only vs. ChIP-all: similar Additional sites
Part 2 Cool story of miRNA targets for a new anti-sense miRNA
Surprise: miR-Anti-sense function A single miRNA locus transcribed from both strands Both processed to mature miRNAs: mir-iab-4, miR-iab-4AS (anti-sense) The two miRNAs show distinct expression domains (mutually exclusive) The two show distinct Hox targets – another Hox master regulator
Surprise: miR-Anti-sense function Mis-expression of mir-iab-4S & AS: altereswingshomeotic transform. Stronger phenotype for AS miRNA Sense/anti-sense pairs as general building blocks for miRNA regulation 9 new anti-sense miRNAs in mouse wing w/bristles Sensory bristles haltere wing haltere WT Note: C,D,E same magnification wing sense Antisense
Part 3 (optional) Discovering motifs
Evolutionary signatures for regulatory motifs Individual motif instances are preferentially conserved Measure conservation across entire genome Over thousands of motif instances Increased discovery power Couple to rapid enumeration and rapid string search De novo discovery of regulatory motifs 5’-UTR 3’-UTR Known engrailed site (footprint) D.mel CAGCT--AGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTC D.sim CAGCT--AGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTC D.sec CAGCT--AGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTC D.yak CAGC--TAGCC-AACTCTCTAATTAGCGACTAAGTC-CAAGTC D.ere CAGCGGTCGCCAAACTCTCTAATTAGCGACCAAGTC-CAAGTC D.ana CACTAGTTCCTAGGCACTCTAATTAGCAAGTTAGTCTCTAGAG ** * * *********** * **** * ** D.mel D. ere D. ana D. pse.
Power of evolutionary signatures for motif discovery Ability to discover full dictionary of regulatory motifs de novo
Tissue-specific enrichment and clustering • Infer candidate functions for novel motifs • Reveal ‘modules’ of co-operating motifs Functional clusters emerge
Discovered motifs show positional biases • May represent new core promoter elements • Show enrichment in distinct functional categories
Recognizing functional motifs in coding regions • Challenge: • Overlapping selective pressures • Most ‘motifs’ from di-codon biases • Hundreds of motifs due to noise • Solution: • Test each frame offset separately • Di-codon biases Frame biased • True motifs Frame unbiased • Result: • Top 20 motifs 11 miRNA seeds • (before: 11 seeds in 200+ motifs) miRNAs Top motifs Ability to distinguish overlapping pressures Evidence of miRNA targeting in coding reg.
miRNA targeting in protein-coding regions • MicroRNA seeds are specifically selected • Coding & 3’UTRs show same conservation profile
Part 4 (optional) Characterizing enhancers
Bound in vivo. Conserved D/Tw/Sn motifs in 12 flies. Clear DV expression pattern (lacZ/end). • Large number of novel enhancers (428 Dorsal/Twi/Sna). They validate! Developmental enhancer identification in Drosophila • Supported by tiling arrays and regulatory motifs (nucleotide resolution) • Identify nearly all known enhancers (20 of 22 highly bound)
Surprise 1: AP genes targeted by DV regulators • Novel DorsoVentral enhancers in known AntPosterior genes • Bound in vivo by DV genes (by all three DV master regulators) • Show evolutionarily conserved motifs for all three DV factors • Yet, found in known AP genes, with clear AP expression patterns Integration of DV and AP patterning networks
Active Repressed Poised Surprise 2: Some silent genes show Pol II binding • Distinct modes of Pol II occupancy • Active genes (27%): Pol II throughout the gene, transcribing • Repressed genes (37%): Pol II simply absent, no expression • Third class (12%): Pol II found only at the TSS, stalled • Qualitatively different: abundantly bound, but strongly punctate • Genes not expressed: known repressed genes, confirmed by arrays • Enriched in development, neurogenesis, ectoderm, muscle differ. • Hypothesis: Developmental genes poised for expression • Reminiscent of ‘bivalent’ K4/K27 domains in mammals
Surprise 3: Master regulators also bind downstream targets • Abundant feed-forward loops in DV patterning • Cooperation of master reg. & downstream reg.
Manolis Kellis - modENCODE analysis - summary • Part 1: Target identification • Comp. vs. Expt: each has unique advantages • Bound & not conserved appear less functional! • Part 2: Target validation (for anti-sense miRNA) • It’s nice when expected outcome comes true • Need more collaborations for target validation • Part 3: Motif discovery • Methods for genome-wide motif discovery • Expect increased power in bound regions • Part 4: Enhancer identification • Many new enhancers – with motifs & validation • AP / DV system cross-talk – expect dense network • PolII stalling: spatial dynamics matter
Who’s actually doing the work Main contributors: Alex Stark Pouya Kheradpour Julia Zeitlinger Collaborators: Targets Sushmita Roy @ UNM iab-4AS Natascha Bushati, Steve Cohen @ EMBL Julius Brennecke, Greg Hannon @ CSHL Calvin Jan, David Bartel @ Whitehead Enhancers Julia Zeitlinger, Rick Young @ Whitehead Robert Zinzen, Mike Levine @ UC Berkeley