1 / 23

Regulation of Cardiac aging and function by miRNAs

This research paper explores the role of microRNAs in the regulation of cardiac aging and function. The study examines the expression levels and effects of miR-34a in the heart, as well as its potential targets and implications for cardiac apoptosis, senescence, and dysfunction.

ccarrie
Télécharger la présentation

Regulation of Cardiac aging and function by miRNAs

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Regulation of Cardiac aging and function by miRNAs Reinier Boon Institute for Cardiovascular Regeneration Center for Molecular Medicine Goethe University, Frankfurt Noordwijkerhout, 15 March 2013

  2. Age is the major risk factor for cardiovascular disease Cardiac fibrosis Hypertrophy Heart failure Cardiomyocyte Apoptosis A role for microRNAs? (Lakatta, Heart Failure Rev 2002) (Kaystura et al., Am. J. Physiol. 1996) (Mewton et al., J Am Coll Cardiol 2011) (Leri et al., Circ Res 2011)

  3. miRNAs bind partially complimentary to target mRNAs One miRNA can have >100 target genes miRNAs play a role in cardiovascular biology (Inui et al., Nat Rev Mol Cell Biol 2010) (Small and Olson, Nature 2011)

  4. Aged heart: Micro-Array Profiling Total RNA miRNA mRNA • Young (6 weeks) and old (18 months) C57Bl6 male mice • Isolate RNA from the heart • MicroRNA profiles and mRNA profiles (micro-arrays)

  5. Aging induces miR-34a in the heart miR-34a:uggcagugucuuagcugguugu miR-34b:uaggcagugucauuagcugauug miR-34c:aggcaguguaguuagcugauugc Alone Together in a cluster miR-34a expression in mouse hearts

  6. MiR-34a is known to play a role in apoptosis and senescence (Hermeking, Cell Death and Differentiation 2010)

  7. MiR-34a inhibition reduces cardiomyocyte apoptosis in vitro

  8. AntagomiR-34a treatment efficiently knocks down miR-34a and inhibits apoptosis in vivo ? miR-34a Cardiac miR-34 levels, 2 days after IV injection 7 days after IV injection

  9. Inhibition of miR-34a in progeria mice rescues cardiac function Ku80-/- progeria model * • Accelerated aging • Immunosenescence • Muscle weakness Relative expression (Vogel H et al. PNAS 1999) Monitoring of heart function by echo Anti-Control * Anti-34a

  10. Maintenance of cardiac function in aged miR-34a-/- mice Monitoring of heart function by echo weeks

  11. Antagomir-34a treatment improves cardiac function after acute myocardial infarction day0 day14 Ejection fraction miR-34a miR-34a levels in the infarct zone Histology: Wall motion score index

  12. How does miR-34a augment cardiac apoptosis? AMI Aging Progeria miR-34a Direct target: SIRT1, etc. Direct target: XX Direct target: XX Apoptosis Cardiac dysfunction

  13. miRanda PicTar 1246 20 140 49 42 125 176 TargetScan 5.1 In silicopredicted targets of miR-34a: PNUTS Only predicted target that is downregulated (<-1.5 fold) by age on the mRNA level (micro-array) (-2.0 fold) Also known as: Protein Phosphatase 1 Nuclear Targeting Subunit (PNUTS)

  14. PNUTS is a direct target of miR-34a PNUTS levels in hearts (3 weeks after i.v. injection) miR-34a PNUTS 3’UTR Luciferase AAAAAAA

  15. PNUTS interacts with telomere regulator TRF2 DNA damage Telomeres PP1 PP1 • PNUTS interacts with TRF2 at telomeres (Kim et al. Nat StructMol Biol. 2009) • TRF2 protects telomeres from degradation and prevents apoptosis (Karlsederet al. Science 1999) PNUTS p-Chk2 • TRF2 and PNUTS localize to DNA Damage • (Bradshaw et al. Nat. Genet. 2005, Landsverket al. EMBO Rep. 2010) TRF2 (Oh H et al. PNAS 2003) miR-34a • TRF2 loss-of-function is linked to human heart failure PNUTS Apoptosis Senescence ? PNUTS TRF2 Apoptosis

  16. PNUTS overexpression rescues miR-34a-induced apoptosis in cardiomyocytesin vitro Lentiviral overexpression

  17. PNUTS reduces Chk2 activation DNA damage Telomeres PP1 PP1 PNUTS p-Chk2 TRF2 Apoptosis Senescence PNUTS TRF2

  18. PNUTS induces telomere maintenance Telomere Q-FISH DNA damage Telomeres PP1 PP1 PNUTS p-Chk2 TRF2 Apoptosis Senescence PNUTS TRF2

  19. PNUTS inhibits DNA damage DNA damage Telomeres PP1 PP1 PNUTS p-Chk2 TRF2 Apoptosis Senescence PNUTS TRF2

  20. Cardiac PNUTS overexpression preserves cardiac function after AMI AAV9 with cardiac-specific promoter 0.26 kb

  21. miR-34a / PNUTS axis controls cardiac aging through regulation of telomeres and DNA damage responses AMI Aging miR-34a Other targets TRF2 PNUTS DNA Damage Response Telomere Dysfunction Apoptosis Fibrosis Hypertrophy Contractile dysfunction AAAAAA

  22. miR-34a / PNUTS axis controls cardiac aging through regulation of telomeres and DNA damage responses

  23. Acknowledgements Goethe University, Frankfurt KazumaIekushi Timon Seeger Susanne Heydt FranziskaGehring NataljaReinfeld Ariane Fischer Marion Muhly-Reinholz Joachim Ehrlich Michael Potente Andreas Zeiher Stefanie Dimmeler Ludwig-Maximilians-University, Munich Stefanie Lechner HeikoHermeking Heidelberg University Clinic Oliver Müller Hugo Katus UMRS787, Paris David Sassoon Giovanna Marazzi VU University, Amsterdam Anton Horrevoets

More Related