chaman
Uploaded by
43 SLIDES
608 VUES
440LIKES

Multiple Sequence Alignments

DESCRIPTION

Multiple Sequence Alignments. Algorithms. MLAGAN: progressive alignment of DNA. Given N sequences, phylogenetic tree Align pairwise, in order of the tree (LAGAN). Human. Baboon. Mouse. Rat. MLAGAN: main steps. Given a collection of sequences, and a phylogenetic tree

1 / 43

Download Presentation
Télécharger la présentation

Multiple Sequence Alignments

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Multiple Sequence Alignments Algorithms

  2. MLAGAN: progressive alignment of DNA Given N sequences, phylogenetic tree Align pairwise, in order of the tree (LAGAN) Human Baboon Mouse Rat

  3. MLAGAN: main steps Given a collection of sequences, and a phylogenetic tree • Find local alignments for every pair of sequences x, y • Find anchors between every pair of sequences, similar to LAGAN anchoring • Progressive alignment • Multi-Anchoring based on reconciling the pairwise anchors • LAGAN-style limited-area DP • Optional refinement steps

  4. MLAGAN: multi-anchoring To anchor the (X/Y), and (Z) alignments: X Z Y Z X/Y Z

  5. Whole-genome alignment Human/Mouse/Rat

  6. Insertion/Deletion Rate Analysis

  7. Heuristics to improve multiple alignments • Iterative refinement schemes • A*-based search • Consistency • Simulated Annealing • …

  8. Iterative Refinement One problem of progressive alignment: • Initial alignments are “frozen” even when new evidence comes Example: x: GAAGTT y: GAC-TT z: GAACTG w: GTACTG Frozen! Now clear correct y = GA-CTT

  9. Iterative Refinement Algorithm (Barton-Stenberg): • Align most similar xi, xj • Align xk most similar to (xixj) • Repeat 2 until (x1…xN) are aligned • For j = 1 to N, Remove xj, and realign to x1…xj-1xj+1…xN • Repeat 4 until convergence Note: Guaranteed to converge

  10. allow y to vary x,z fixed projection Iterative Refinement For each sequence y • Remove y • Realign y (while rest fixed) z x y

  11. Iterative Refinement Example: align (x,y), (z,w), (xy, zw): x: GAAGTTA y: GAC-TTA z: GAACTGA w: GTACTGA After realigning y: x: GAAGTTA y: G-ACTTA + 3 matches z: GAACTGA w: GTACTGA

  12. Iterative Refinement Example not handled well: x: GAAGTTA y1: GAC-TTA y2: GAC-TTA y3: GAC-TTA z: GAACTGA w: GTACTGA • Realigning any single yi changes nothing

  13. Restricted MDP • Run MDP, restricted to radius R from m z x y Running Time: O(2N RN-1 L)

  14. Tree Refinement Run 3D-DP, restricted to radius R from m, for each tree node z x y Running Time: ~7R2 LN R: Radius L: Alignment Length N: Number of Sequences

  15. A* for Multiple Alignments Review of the A* algorithm h(v) g(v) v GOAL START • g(v) is the cost so far • h(v) is an estimate of the minimum cost from v to GOAL • f(v) ≥ g(v) + h(v) is the minimum cost of a path passing by v • Expand v with the smallest f(v) • Never expand v, if f(v) ≥ shortest path to the goal found so far

  16. A* for Multiple Alignments • Nodes: Cells in the DP matrix • g(v): alignment cost so far • h(v): sum-of-pairs of individual pairwise alignments • Initial minimum alignment cost estimate: sum-of-pairs of global pairwise alignments h(v) g(v) v GOAL START

  17. Consistency – T-Coffee zk z xi x y yj yj’

  18. T – Coffee Layout LALIGN CLUSTALW

  19. Generating Primary Library A A A B B B A A C C B B B C C C ClustalW Primary Library Lalign Primary Library (10 top scoring non–intersecting Local (Global pairwise alignment) (Pairwise alignment) Library has information for each N(N-1)/2 sequence pairs.

  20. Seq A GARFIELD THE LAST FAT CAT Seq B GARFIELD THE FAST CAT - - - Seq A GARFIELD THE LAST FAT CAT Seq D - - - -- - -- THE - - - - FAT CAT Seq B GARFIELD THE FAST CAT Seq D - - - - -- - THE FA-T CAT Prim. Weight = 100 Prim. Weight = 100 Prim. Weight = 88 Seq B GARFIELD THE - - - - FAST CAT Seq C GARFIELD THE VERY FAST CAT Prim. Weight = 100 Seq A GARFIELD THE LAST FA-T CAT Seq C GARFIELD THE VERY FAST --- Prim. Weight = 77 Seq C GARFIELD THE VERY FAST CAT Seq D - - - -- -- - THE - - - - FA-T CAT Prim. Weight = 100 Primary Library

  21. Seq AGARFIELD THE LAST FAT CAT Seq BGARFIELD THE FAST CAT - - - Combining the libraries Primary weight(ClustalW)=88 Primary Weight(Lalign)=88 W(A(G),B(G)) = 88 + 88 = 176 If a pair is duplicated across the two libraries, it is merged into single entry with weight = sum of two weights pairs of residue that did not occur are not present ( weight 0 )

  22. Library Extension • Complete extension requires examination of all triplets. • Not all bring information ( eg. A and B through D ). • Weight of a pair = weights gathered through examination • of all triplets involving that pair.

  23. Running Time • Complexity of entire procedure: O(N2 * L2) + O(N3*L) + O(N3) + O(N*L2) O(N2 L2) - pair-wise library computation O(N3 L) - library extension O(N3) - computation of NJ tree O(N L2) - progressive alignment computation Where: L – average sequence length N – number of sequences

  24. T-Coffee compared with other methods

  25. Gene Recognition Credits for slides: Marina Alexandersson Lior Pachter Serge Saxonov

  26. Reading • GENSCAN • EasyGene • SLAM • Twinscan Optional: Chris Burge’s Thesis

  27. DNA transcription RNA translation Protein Gene expression CCTGAGCCAACTATTGATGAA CCUGAGCCAACUAUUGAUGAA PEPTIDE

  28. Gene structure intron1 intron2 exon2 exon3 exon1 transcription splicing translation exon = coding intron = non-coding

  29. Exon 3 Exon 1 Exon 2 Intron 1 Intron 2 5’ 3’ Stop codon TAG/TGA/TAA Start codon ATG Finding genes Splice sites

  30. Approaches to gene finding • Homology • BLAST, Procrustes. • Ab initio • Genscan, Genie, GeneID. • Hybrids • GenomeScan, GenieEST, Twinscan, SGP, ROSETTA, CEM, TBLASTX, SLAM.

  31. HMMs for single species gene finding: Generalized HMMs

  32. intron exon exon intron intergene exon intergene HMMs for gene finding GTCAGAGTAGCAAAGTAGACACTCCAGTAACGC

  33. T A A T A T G T C C A C G G G T A T T G A G C A T T G T A C A C G G G G T A T T G A G C A T G T A A T G A A Exon1 Exon2 Exon3 GHMM for gene finding duration

  34. Observed duration times

  35. Better way to do it: negative binomial • EasyGene: Prokaryotic gene-finder Larsen TS, Krogh A • Negative binomial with n = 3

  36. Biology of Splicing (http://genes.mit.edu/chris/)

  37. Consensus splice sites Donor: 7.9 bits Acceptor: 9.4 bits (Stephens & Schneider, 1996) (http://www-lmmb.ncifcrf.gov/~toms/sequencelogo.html)

  38. Donor site 5’ 3’ Position % Splice site detection

  39. Splice Site Models • WMM: weight matrix model = PSSM (Staden 1984) • WAM: weight array model = 1st order Markov (Zhang & Marr 1993) • MDD: maximal dependence decomposition (Burge & Karlin 1997) decision-tree like algorithm to take significant pairwise dependencies into account

  40. atg caggtg ggtgag cagatg ggtgag cagttg ggtgag caggcc ggtgag tga

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer