jereni
Uploaded by
40 SLIDES
593 VUES
410LIKES

Multiple Sequence Alignments

DESCRIPTION

Multiple Sequence Alignments. z. x. y. The Global Alignment problem. AGTGCCCTGGAACCCTGACGGTGGGTCACAAAACTTCTGGA. AGTGACCTGGGAAGACCCTGACCCTGGGTCACAAAACTC. A - T. A G -. G T T. G G G. G T G. G - -. T - A. T T A. - - A. - T A. C C A. C C C. - G C. - G -.

1 / 40

Télécharger la présentation

Multiple Sequence Alignments

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Multiple Sequence Alignments .

  2. z x y The Global Alignment problem AGTGCCCTGGAACCCTGACGGTGGGTCACAAAACTTCTGGA AGTGACCTGGGAAGACCCTGACCCTGGGTCACAAAACTC

  3. A - T A G - G T T G G G G T G G - - T - A T T A - - A - T A C C A C C C - G C - G - Possible alignment Possible alignment Multiple Sequence Alignment S1=AGGTC S2=GTTCG S3=TGAAC

  4. Motivations • Protein databases categorized by protein families • Collection of proteins with similar structure, function, or evolutionary history • Comparing a new protein with a family requires to construct a representation of the family and then compare the new protein with the family representation • How to score a multiple alignment ? • Consensus Distance • Evolutionary Tree Distance • Sum-of-Pairs Distance

  5. Definition • Given N sequences x1, x2,…, xN: • Insert gaps (-) in each sequence xi, such that • All sequences have the same length L • Score of the global map is maximum • A faint similarity between two sequences becomes significant if present in many • Multiple alignments can help improve the pairwise alignments

  6. Definition: The sum-of-pairs (SP) value for a multiple global alignment A of k strings is the sum of the values of all pairwise alignments induced by A Multiple Sequence Alignment • Definition: Given stings S1,S2,…,Ska multiple (global) alignment map them to strings S’1,S’2,…,S’k that may contain spaces, where: • |S’1|= |S’2|=…= |S’k| • The removal of spaces from S’ileaves Si

  7. Scoring Function: Sum Of Pairs Definition:Induced pairwise alignment A pairwise alignment induced by the multiple alignment Example: x: AC-GCGG-C y: AC-GC-GAG z: GCCGC-GAG Induces: x: ACGCGG-C; x: AC-GCGG-C; y: AC-GCGAG y: ACGC-GAC; z: GCCGC-GAG; z: GCCGCGAG

  8. Time Complexity: O(k2knk) Multiple Sequence Alignment Given k strings of length n, there is a generalization of the dynamic programming algorithm that finds an optimal SP alignment. • NP completeness: • Instead of a 2-dimensional table we now have a k-dimensional table to fill. O(nk) cells to fill • Each dimension’s size is n+1. Each entry depends on 2k - 1 adjacent entries.

  9. Multidimensional Dynamic Programming Generalization of Needleman-Wunsh: S(m) = i S(mi) (sum of column scores) F(i1,i2,…,iN): Optimal alignment up to (i1, …, iN) F(i1,i2,…,iN) = max(all neighbors of cube)(F(nbr)+S(nbr))

  10. Multidimensional Dynamic Programming • Example: in 3D (three sequences): • 7 neighbors/cells F(i,j,k) = max{ F(i-1,j-1,k-1)+S(xi, xj, xk), F(i-1,j-1,k )+S(xi, xj, - ), F(i-1,j ,k-1)+S(xi, -, xk), F(i-1,j ,k )+S(xi, -, - ), F(i ,j-1,k-1)+S( -, xj, xk), F(i ,j-1,k )+S( -, xj, xk), F(i ,j ,k-1)+S( -, -, xk) }

  11. x1 x2 x3 x4 Multiple alignments We use a matrix to represent the alignment of k sequences, K=(x1,...,xk). We assume no columns consists solely of blanks. The common scoring functions give a score to each column, and set: score(K)=∑i score(column(i)) For k=10, a scoring function has 2k -1 > 1000 entries to specify. The scoring function is symmetric - the order of arguments need not matter: score(I,_,I,V) = score(_,I,I,V).

  12. SUM OF PAIRS A common scoring function is SP – sum of scores of the projected pairwise alignments: SPscore(K)=∑i<j score(xi,xj). Note that we need to specify the score(-,-) because a column may have several blanks (as long as not all entries are blanks). In order for this score to be written as∑i score(column(i)), we set score(-,-) = 0. Why ? Because these entries appear in the sum of columns but not in the sum of projected pairwise alignments (rows).

  13. Definition: The sum-of-pairs (SP) value for a multiple global alignment A of k strings is the sum of the values of all projected pairwise alignments induced by A where the pairwise alignment function score(xi,xj) is additive. SUM OF PAIRS

  14. Example Consider the following alignment: a c - c d b - - c - a d b d a - b c d a d Using the edit distance and for , this alignment has a SP value of 3 + 4 + 5 = 12

  15. Multidimensional Dynamic Programming Running Time: • Size of matrix: LN; Where L = length of each sequence N = number of sequences • Neighbors/cell: 2N – 1 Therefore………………………… O(2N LN) • How do affine gaps generalize? • VERY badly! • Require 2N states, one per combination of gapped/ungapped sequences • Running time: O(2N 2N  LN) = O(4N LN) Y YZ XY XYZ Z X XZ

  16. For each vector i =(i1,..,ik), compute an optimal multiple alignment for the k prefix sequences x1(1,..,i1),...,xk(1,..,ik). The adjacent entries are those that differ in their index by one or zero. Each entry depends on 2k-1 adjacent entries. Multiple Sequence Alignment Given k strings of length n, there is a natural generalization of the dynamic programming algorithm that finds an alignment that maximizes SP-score(K) = ∑i<j score(xi,xj). Instead of a 2-dimensional table, we now have a k-dimensional table to fill.

  17. The idea via K=2 Recall the notation: and the following recurrence for V: Note that the new cell index (i+1,j+1) differs from previous indices by one of 2k-1 non-zero binary vectors (1,1), (1,0), (0,1).

  18. The idea for arbitrary k Order the vectors i=(i1,..,ik) by increasing order of the sum ∑ij. Set s(0,..,0)=0, and for i > (0,...,0): Where • The vector b ranges over all non-zero binary vectors. • The vector i-b is the non-negative difference of i and b. • The jth entry of column(i,b)equals cj=xj(ij) if bi=1, and cj= ‘-’ otherwise. • (Reflecting that b is 1 at location j if that location changed in the “current comparison”).

  19. Complexity of the DP approach Number of cells nk. Number of adjacent cells O(2k). Computation of SP score for each column(i,b) is O(k2) Total run time is O(k22knk) which is utterly unacceptable ! Not much hope for a polynomial algorithm because the problem has been shown to be NP complete. Need heuristic to reduce time.

  20. x1 x2 x3 x4 Time saving heuristics: Relevance tests Heuristic: Avoid computing score(i) for irrelevant vectors. Let L be a lower bound on the optimal SP score of a multiple alignment of the k sequences. A lower bound L can be obtained from an arbitrary multiple alignment, computed in any way. Main idea: Compute upper bounds H(u,v) for the optimal score for every two sequences s=xu and t=xv, 1  u < v  k. When processing vector i=(..iu,..iv…), the relevant cells are such that in every projection on xu and xv, the optimal pairwise score is above a value based on H(u,v) and L.

  21. t s Recall the Linear Space algorithm • V[i,j] = d(s[1..i],t[1..j]) • B[i,j] = d(s[i+1..n],t[j+1..m]) • F[i,j] + B[i,j] = score of best alignment through (i,j) These computations done in linear space. Build such a table for every two sequences s=xu and t=xv, 1  u, v  k. This entry encodes the optimum through (iu,iv).

  22. Time saving heuristics:Relevance test Let S(u,v) the score of the alignment of xu and xv in the multiple alignment. Then, we have: L ≤ S(u,v) – H(u,v) + And then: S(u,v) ≥ L + H(u,v) – Now for each pair u,v we want to consider only the cells Iu and Iv for which the best pairwise alignment score that can be obtained through them (that is ) is greater than the above value: ≥ L + H(u,v) -

  23. A Profile Representation of Multiple Alignment - A G G C T A T C A C C T G T A G – C T A C C A - - - G C A G – C T A C C A - - - G C A G – C T A T C A C – G G C A G – C T A T C G C – G G A 1 1 .8 C .6 1 .4 1 .6 .2 G 1 .2 .2 .4 1 T .2 1 .6 .2 O .2 .8 .4 .4 E .4 C .2 .8 .4 .2 • Given a multiple alignment M = m1…mn • Replace each column mi with profile entry pi • Frequency of each letter in  • # gaps • Optional: # gap openings, extensions, closings

  24. Multiple Alignments With Profile • Its corresponding profile P is • C1 C2 C3 C4 C5 • a 75% 25% 50% • b 75% 75% • c 25% 25% 50% 25% • − 25% 25% 25% • Consider the MSA a b c - a a b a b a a c c b - c b - b c Aligning a string S to a profile P will tell us how well S fits P. Given the column positions C of P, the alignment consists of inserting spaces into S and C=(1,2,3,4,5) as in pure string alignment. For instance, an alignment of aabbc to P is: a a b - b c 1 - 2 3 4 5

  25. String-to-Profile Alignment • Scoring a column j is equivalent to aligning Sj to each character at column j. σ(j) = sum{over all i}σ(Sj, ij)pij pij is frequency of i-th character in column j, • Score of an alignment = sum of all column scores σ(j). • Use Dynamic Programming as before (NW, SW, …) to do a string-to-profile alignment • Except that you should use this scoring function defined above. • Profile-to-Profile Alignments?

  26. Progressive Alignment • When evolutionary tree is known: • Align closest first, in the order of the tree • In each step, align two sequences x, y, or profiles px, py, to generate a new alignment with associated profile presult Weighted version: • Tree edges have weights, proportional to the divergence in that edge • New profile is a weighted average of two old profiles x y z w

  27. Example Profile: (A, C, G, T, -) px = (0.8, 0.2, 0, 0, 0) py = (0.6, 0, 0, 0, 0.4) s(px, py) = 0.8*0.6*s(A, A) + 0.2*0.6*s(C, A) + 0.8*0.4*s(A, -) + 0.2*0.4*s(C, -) Result:pxy= (0.7, 0.1, 0, 0, 0.2) s(px, -) = 0.8*1.0*s(A, -) + 0.2*1.0*s(C, -) Result:px-= (0.4, 0.1, 0, 0, 0.5)

  28. Progressive Alignment • When evolutionary tree is unknown: • Perform all pairwise alignments • Define distance matrix D, where D(x, y) is a measure of evolutionary distance, based on pairwise alignment • Construct a tree (we will describe more in detail later in the course) • Align on the tree x y ? z w

  29. CLUSTALW • (1). Perform pairwise alignments of all sequences • (2). Use alignment scores to produce a phylogenetic tree • (3). Align the sequences sequentially by the tree that is based on genetic distances. -- The most closely related sequences are aligned first, then additional sequences or groups are added according to initial alignments -- Genetic distance: no. of mismatched positions divided by the total no. of matched positions (positions opposite a gap are not scored) -- Sequence contributions to MSA are weighted according to their relationships on the tree -- weighting scheme: the more distant, the higher the weight -- Context (neighbor amino acid) is taken into account for the gap penality -- Gap score is adapted to force gaps to open at the same position.

  30. Pairwise alignment S1 sequence S3 sequence S2 sequence S5 sequence S6 sequence S1 S3 S2 S5 S6 First align S1 and S3, S5 and S6, then align (S5,S6) and S2. Finally

  31. Tree Alignments • Assume that there is a tree T=(V,E) whose leaves are the sequences. • Associate a sequence in each internal node. • Tree-score(K) = ∑(i,j)Escore(xi,xj). • Finding the optimal assignment of sequences to the internal nodes is NP Hard. We will meet again this problem in the study of Phylogenetic trees

  32. Star Alignments Rather then summing up all pairwise alignments, select a fixed sequence x0 as a center, and set Star-score(K) = ∑j>0score(x0,xj). The algorithm to find optimal alignment: at each step, add another sequence aligned with x0, keeping old gaps and possibly adding new ones.

  33. Multiple Sequence Alignment – Approximation Algorithm • Polynomial time algorithm: • assumption: the cost function δ is a distance function: • (triangle inequality) • Let D(S,T) be the value of the minimum global alignment between S and T.

  34. Polynomial time algorithm: The input is a set Γ of k strings Si. 1. Find the string S1 that minimizes Multiple Sequence Alignment – Approximation Algorithm (cont.) • 2. Call the remaining strings S2,…,Sk. • 3. Add a string to the multiple alignment that initially contains only S1 as follows: • Suppose S1,…,Si-1are alreadyaligned as S’1,…,S’i-1. Add Si by running dynamic programming algorithm on S’1 and Si to produce S’’1 and S’i. • Adjust S’2,…,S’i-1 by adding spaces to those columns where spaces were added to get S’’1 from S’1. • Replace S’1 by S’’1.

  35. Multiple Sequence Alignment – Approximation Algorithm (cont.) • Time analysis: • Choosing S1 – running dynamic programming algorithm • times – O(k2n2) • When Si is added to the multiple alignment, the length of S1 • is at most in, so the time to add all k strings is

  36. For all i, d(1,i)=D(S1,Si) (we performed optimal alignment between S’1 and Si and ) Multiple Sequence Alignment – Approximation Algorithm (cont.) • Error analysis: • M - The alignment produced by this algorithm. • d(i,j) - the distance M induces on the pair Si,Sj. • M* - optimal alignment.

  37. Definition of S1 Multiple Sequence Alignment – Approximation Algorithm (cont.) Triangle inequality • Error analysis:

  38. Iterative Refinement Algorithm (Barton-Stenberg): • Align most similar xi, xj • Align xk most similar to (xixj) • Repeat 2 until (x1…xN) are aligned • For j = 1 to N, Remove xj, and realign to x1…xj-1xj+1…xN • Repeat 4 until convergence Note: Guaranteed to converge

  39. Some Resources Genome Resources Annotation and alignment genome browser at UCSC http://genome.ucsc.edu/cgi-bin/hgGateway Specialized VISTA alignment browser at LBNL http://pipeline.lbl.gov/cgi-bin/gateway2 ABC—Nice Stanford tool for browsing alignments http://encode.stanford.edu/~asimenos/ABC/ Protein Multiple Aligners http://www.ebi.ac.uk/clustalw/ CLUSTALW – most widely used http://phylogenomics.berkeley.edu/cgi-bin/muscle/input_muscle.py MUSCLE – most scalable http://probcons.stanford.edu/ PROBCONS – most accurate

More Related