1 / 73

Institute of Biomedical Sciences Academia Sinica

CBMB2008. III. Structure determination: Nucleic Acids. by NMR spectroscopy. Iren Wang 王怡人. Institute of Biomedical Sciences Academia Sinica. 2008. May 8. Outline. I. Nucleic acids hold diverse structures and functions a. In vitro SELEX b. Diverse structures of nucleic acids

chance
Télécharger la présentation

Institute of Biomedical Sciences Academia Sinica

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. CBMB2008 III. Structure determination: Nucleic Acids by NMR spectroscopy Iren Wang 王怡人 Institute of Biomedical Sciences Academia Sinica 2008. May 8

  2. Outline I. Nucleic acids hold diverse structures and functions a. In vitro SELEX b. Diverse structures of nucleic acids II. NMR Spectroscopy for Nucleic Acid Assignment a. The building blocks of nucleic acids b. Resonance assignment in nucleic acids III. Some application cases for protein-nucleic acids complexes IV. Others (Advanced developments in NMR Spectroscopy) a.Residual Dipolar Coupling (RDC) b. Transverse Relaxation-Optimized Spectroscopy (TROSY) c. Paramagnetic spin labeling

  3. I. Nucleic acids hold diverse structures and functions

  4. Postulated stem-loop diagram of the 5’ untranslated region of HIV-1HXB2 genomic RNA Biochemistry (2008) 10, p.3283-93. Nucleic Acids Res. (2008) May, p.1-17 Nucleic acids hold diverse functions ** the genetic information carriers ** tRNA: transporters of genetic information mRNA: a copy of the information carried by a gene on the DNA rRNA: a component of the ribosomes snRNA (small nuclear RNA): important in a number of processes including RNA splicing and maintenance of the telomeres, or chromosome ends ** targets for proteins and/or drugs interaction

  5. In vitro SELEX (systematic evolution of ligands by exponential enrichment) an excellent tool for finding nucleotide molecules that have a high affinity for a particular target from a random pool under specific conditions. Three processes: Selection of ligand sequences, Partitioning of aptamers, amplification of bound aptamers Anal Bioanal Chem (2007) 387, p.171-82.

  6. Nucleic acids hold diverse structures The possible conformations formed by poly-nucleotides in solution are flexible, “unstructured” single strands, stacked helical single strands, hairpins, regular duplexes formed by complementary strands, and a variety of aggregates between partially complementary strands, which may contain bulges, dangling ends, or stacked single stranded ends. DNA duplexes, triplex, multi-stranded G-quadruplex structures RNA structural elements: helices, hairpins, bulges, junctions, pseudoknots ** non-helical conformations and tertiary structure are stabilized by: metal ions, water-mediated H-bonds, and stacking interactions ** formation of a double-stranded helix is driven by cooperative attractive hydrogen bonding and stacking interactions ** U-turn / reversed U-turn of RNA: sharp turns in hairpin loops ** the diversity of RNA structures compared to DNA is a result of non-helical secondary structure ** non Watson-Crick base pairs are important for RNA/RNA and RNA/protein recognition

  7. Telomeric DNA quadruplex structures The arrangement of hydrogen bonds between guanines in a G-tetrad Current Opinion in Structural Biology (2003) 13, p.275-83.

  8. Secondary structure of the T arm and pseudoknotted acceptor arm of the tRNA-like structure of TYMV genomic RNA Stem 2 Loop 1 Loop 1 Science (1998) 280, P.434-8.

  9. RNA structure By Michael Sattler

  10. Proteins recognize unusual RNA structural elements RNA structure: protein recognition By stabilizing an adjacent interaction surface, bulges can participate in complex protein binding sites. Structure (2000) 8, R47-R54.

  11. stacked flipped-out groove-binding flap residues RNA bugles as architectural and recognition motifs Bulges: unpaired stretches of nucleotides located within one strand of a nucleic acid duplex -sizes: vary from a single unpaired residue up to several nucleotides Structure (2000) 8, R47-R54.

  12. RNA bugles as architectural and recognition motifs Bugles stabilization by metal ions Bugles distortions Structure (2000) 8, R47-R54.

  13. Non-Watson–Crick base pairs employ non-standard H-bonds bifurcated H-bonds cis Watson-Crick G*A water-mediated open, water-mediated Watson-Crick G*A C-H N/O H-bond Structure (2000) 8, R55-R65.

  14. II. NMR Spectroscopy for Nucleic Acid Assignment

  15. Nucleic acid bases, nucleosides, nucleotides Nomenclature, structures, and atom numbering for the sugars contained in common Nucleotides.

  16. Labile protons Nomenclature, structures, and atom numbering for the bases contained in common Nucleotides.

  17. Torsion Angles in Nucleic Acids By Michael Sattler

  18. (A) (B) (C) Sugar pucker, pseudorotation A. Puckering of five-membered ring into envelope (E) and twist (T) forms. B. Definition of sugar puckering modes C. Pseudorotation cycle of the furanose ring in nucleosides. NMR of Proteins and Nucleic acids (1986) by Kurt Wüthrich

  19. Syn/anti conformations – the χ torsion angle NMR of Proteins and Nucleic acids (1986) by Kurt Wüthrich

  20. H2 H6 H8 H2’ H3’ H4’ H5’ H5’’ CH3 H1’ H5 1D 1H NMR spectrum in Nucleic Acids (in D2O)

  21. aromatic imino amino 1D 1H NMR spectrum in Nucleic Acids (in H2O)

  22. I (H2O) Assignment of imino (and amino) resonances to establish base pairing NOESY imino-imino, amino-imino II (H2O) Partial resonance assignment of non-exchangeable protons via NOE connectivities to amino and/or imino protons NOESY imino-H2/H6/H8/H5/H1’ III (D2O) Identification of sugar proton spin systems (mainly H1’/H2’/H2’’/H3’) (1H, 1H) COSY/TOCSY Identification of aromatic spin systems (Cytosine/Thymine H5/H6) (1H, 1H) COSY/TOCSY Sequential resonance assignment NOESY H6/H8-H1’, H6/H8-H2’H2’’ IV (D2O) Assignment of 31P resonances and confirm/extend H3’,H4’,H5’,H5’’ assignments (1H, 31P) HETCOR/HETTOC Flowcharts for resonance assignment in nucleic acids A. NOE-based assignment in unlabeled nucleic acids Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.

  23. I (H2O) Exchangeable proton/nitrogen correlation 2D 15N-HMQC imino 1H optimized G N1H, U N3H amino 1H optimized C N4H2, G N2H2, A N6H2 Exchangeable proton/nitrogen sequential assignment 3D 15N-NOESY-HMQC (imino 15N edited NOESY) imino-imino, amino-imino 3D 15N-NOESY-HMQC (amino 15N edited NOESY) amino-imino II (H2O) Partial resonance assignment of non-exchangeable proton from NOE connectivities with amino and/or imino protons 3D 15N-NOESY-HMQC (imino 15N edited NOESY) aromatic-imino Flowcharts for resonance assignment in nucleic acids B. NOE-based assignment in labeled nucleic acids Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.

  24. (continued) B. NOE-based assignment in labeled nucleic acids III (D2O) Identification of sugar proton spin systems 3D HCCH-COSY H1’-H2’ 3D HCCH-RELAY H1’-H2’/H3’ 3D HCCH-TOCSY Identification of sugar carbon spin systems 2D 13C-CT-HSQC/HMQC 3D HCCH-COSY H1’-C2’ 3D HCCH-RELAY H1’-C2’/C3’ 3D HCCH-TOCSY H1’-C2’/C3’/C4’/C5’ Identification of proton/carbon aromatic spin systems 2D 13C-CT-HSQC/HMQC H6-C6, H8-C8, H5-C5, H2-C2 2D/3D HCCH-COSY H6-H5, H6-C6/ C5, H5-C6/ C5 Sequential resonance assignment 3D 13C-NOESY-HMQC H6/H8-H1’, H6/H8-H2’H2’’ IV (D2O) Assignment of 31P resonances e.g. (1H, 31P) HETCOR/HETTOC Flowcharts for resonance assignment in nucleic acids Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.

  25. Flowcharts for resonance assignment in nucleic acids C. Assignment via through-bond coherence transfer in labeled nucleic acids I (H2O) Exchangeable proton/nitrogen correlation 2D 15N-HMQC imino 1H optimized G N1H, U N3H amino 1H optimized C N4H2, G N2H2, A N6H2 II (H2O) Through-bond amino/imino to non-exchangeable base proton correlations HNCCH/HCCNH III (D2O) 1. Through-bond H2-H8 correlations {HCCH-TOCSY/(1H,13C) HMBC} 2. Through-bond base-sugar correlations {HCN (base) with HCN (sugar), HCNCH, HCNH, {HCN (sugar) with H8N9(H8)C8H8}, {HCN (sugar) with (Hb,Hb) HSQC}, {(H1’, C8/6) HSQC with (H8/6, C8/6) HSQC} 3. Through-bond sugar correlations {HCCH-COSY/ HCCH-TOCSY} 4. Sequential resonance assignment via through-bond sugar-phosphate backbone correlations (1H, 13C, 31P) HCP/ PCH/ PCCH-TOCSY/ HPHCH Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387.

  26. NOE-based assignment in unlabeled nucleic acids

  27. 10 15 20 1 5 5'–CGACGATGACGTCATCGTCG-3' 3'-GCTGCTACTGCAGTAGCAGC-5' 8G H 5G 10 5 1 20 15 H H H N O N 17G N H G N C N H 11G b 2G N N R O N H R imino proton H H 7T Me H N O H N 15T N 12T A T N H N H a N N R H O R 18T imino proton I. Assignment of imino (and amino) resonances in H2O Imino Proton Assignments by 2D NOESY spectrum J. Chin. Chem. Soc. (1999) 46, p.699-708.

  28. 1 H H8 H5 H N O N N H6 G N C N H N N R O N H R 6 H 5 7 3 H Me H N O H8 4 N 2 N A T N H N H6 N N R H2 O R II. NOESY imino-H2/H6/H8/H5/H1’ in H2O Imino Proton to Amino to Aromatic Protons d. Aromatic to H2’/H2” b. Imino to amino/aromatic c. Amino to aromatic a. Imino to imino

  29. b. Imino to amino/aromatic H5 H H8 H5 H N O N N H6 G N C N H N N R O N H R H H Me H N O H8 N H2 N A T N H N 6H N N R H2 O R II. NOESY imino-H2/H6/H8/H5/H1’ in H2O Imino Proton to Amino and Aromatic J. Chin. Chem. Soc. (1999) 46, p.699-708.

  30. III. Identification of aromatic spin systems in D2O Only intra-strand aromatic to aromatic connectivities J. Chin. Chem. Soc. (1999) 46, p.699-708.

  31. Cytosine: CH5-CH6 III. Sequential resonance assignment in D2O NOESY H6/H8-H1’, H6/H8-H2’H2’’ JMB (1983) 171, p.319-36. Duplex-hairpin 5'–CGCGTATACGCG-3' Nucleic Acids Res. (1985) 13, p.3755-72.

  32. III. Sequential resonance assignment in D2O NOESY H6/H8-H1’ Only intra-residue cross peaks were marked. a-f. are the six big CH5-CH6 cross peaks. J. Chin. Chem. Soc. (1999) 46, p.699-708.

  33. III. Sequential resonance assignment in D2O NOESY H6/H8-H2’H2’’ Only intra-residue cross peaks were marked. J. Chin. Chem. Soc. (1999) 46, p.699-708.

  34. 2 3 4 5 6 7 8 9 10 11 5’ G-p-C-p-G-p-A-p-T-p-A-p-G-p-A-p-G-p-C-p-G G-p-C-p-G-p-A-p-G-p-A-p-T-p-A-p-G-p-C-p-G 5’ b) 7p 6A 7G 11 10 9 8 7 6 5 4 3 2 2C 3p 3G 5T 6A 6p 8A 9G 2C 2p, 5p, 9p 4A 5T 1G 11G 11p 10C 9G 10p 10C 31P Phosphate buffer 7G 8A 8p 4A 4p 3G 1H-31P Correlation Spectrum (n-1) H3'- (n) P (n) P - (n) H4' JACS (1992) 114, 3114-5.

  35. NOE-based and via through-bond coherence transfer assignment in labeled nucleic acids

  36. Transcription dTrA dCrG dGrC dArU DNA RNA Transcription starting T7 polymerase DNA template 3’ ATTATGCTGAGTGATATCCTTATACTATGTAAACTAGTCATATAGG 5’ 5’ TAATACGACTCACTATAG 3’ Top strand 3’ 5’ RNA synthesized GGAUUAUGAUACAUUUGAUCAGUAUAUCC RNA synthesis by in vitro transcription RNA samples at natural isotopic abundance and enriched in 15N and 13C can be prepared with T7 RNA polymerase.

  37. Heteronuclear Chemical Shifts in Nucleotides Current Protocols in Nucleic Acid Chemistry (2000) 7.7.1-7.7.30

  38. 2D 15N–1H HMQC spectra of RNA imino resonances at different conditions PNAS (1997) 94, p.2139-44.

  39. The 1H-13C HSQC spectra of labeled nucleic acids (A) H6/H8-C6/C8, (B) H1’-C1’, (C) H2’/H2’’-C2’, and (D) H3’-C3’

  40. H2-H8 or H5-H6 correlation H1’,H2’, H3’ H4’H5’H5” correlations, HCCH-TOCSY H8-H1’ correlation, HCN Intraresidue correlation via through-bond coherence transfer NMR experiments Adenine Nucleotide spin system

  41. Correlation in the base-sugar: HCN 3D spectra 2D and 3D TROSY-HCN for obtaining ribose base and intra-base correlations in the nucleotides of DNA and RNA. Dotted arrows indicate the intra-base transfers and solid arrows the ribose-base transfers. H6/H8 H1’ JACS. 2001, 123, 658-64.

  42. 3D HCCH-TOCSY H1’ Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p.287-387

  43. H3’-C3’-P(n-1) Residue n H5’,H5’’(n-1)-C5’(n-1)-P(n-1) Interresidue correlation through bond (HCP) 2 spin systems can be linked Adenine Guanine OH Progress in Nuclear Magnetic Resonance Spectroscopy (1998) 32, p. 287-387

  44. the connectivity between 1H3(U329) and the 1H2-13C2 (A32) JNN HNN-COSY JHN HSQC 3D13C-NOESY 1H2 (A) to 15N1(A) and 15N3(A) Direct observation of H-bonds in nucleic acid base pairs by inter-nucleotide 2JNN couplings 1H3-15N3(U) to 15N1(A) JACS. (1998) 120, 8293-7.

  45. 3’ 5’ Distance constraints (NOEs) Dihedral angles constraints (J-coupling) Distance geometry calculator (XPLOR-NIH) 3’ 5’ Structural Determination of Nucleic Acids by NMR • Similar to those used in protein • First build a nucleic acid sequence template • Input H-bonded constraints • Input all exchangeable and non-exchangeable distance constraints and/or dihedral constraints • Use Distance Geometry calculation to get some initial structures • Use Molecular Dynamics method to refine the structures

  46. III. Some application cases for protein-nucleic acids complexes

  47. NMR spectroscopy as a tool for secondary structure determination of large RNAs. Annu. Rev. Biophys. Biomol. Struct. (2006) 35,p.319-42.

  48. The structure of HCV IRES domain II Dependence of RDC values on the orientation of the interdipolar vector (C-H) and the alignment tensor Refinement of the HCV IRES domain II structures calculated by the use of different sets of RDCs Rmsd = 7.48Å Rmsd = 5.79Å Rmsd = 2.18Å Annu. Rev. Biophys. Biomol. Struct. (2006) 35,p.319-42.

  49. Helix-turn-helix (HTH) domain Zinc-finger (ZF) domain The common DNA recognition motifs By Dr. Song Tan

  50. S204 Chemical shift change plot based on NMR titration data N- C- a3 Recognition helix N196 a1 G213 E172 N196 S204 G213 Wing a2 E172 The common DNA recognition motifs Winged-helix (WH) domain

More Related