colman
Uploaded by
27 SLIDES
452 VUES
280LIKES

Dynamic Programming: BLAST

DESCRIPTION

Doug Raiford Lesson 5. Dynamic Programming: BLAST. Left off…. Recursive alignment solution exponential. Number of sub-problems 3 n This is exponential. And so on. Complexity analysis. Fixed: best Linear: next best Polynomial (n 2 ): not bad Exponential (3 n ): very bad Big O notation

1 / 27

Télécharger la présentation

Dynamic Programming: BLAST

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Doug Raiford Lesson 5 Dynamic Programming: BLAST

  2. Left off… • Recursive alignment solution exponential Number of sub-problems 3n This is exponential And so on BLAST

  3. Complexity analysis • Fixed: best • Linear: next best • Polynomial (n2): not bad • Exponential (3n): very bad • Big O notation • O(1), O(n), O(n3), O(3n) Big ONotation BLAST

  4. How can improve the complexity of alignment? • If a recursive algorithm solves the same sub-problems over and over… • Just keep track of them, and don’t redo BLAST

  5. Known as dynamic programming • Needleman-Wunsch algorithm • ac__tcg • acagtag • Could maintain a hash of all visited solutions • But there is actually a more elegant solution • Maintain a matrix of scores • Mismatch penalty multiples in first row/column BLAST

  6. Populating the table • Scoring • Match: +1 • Mismatch: 0 • Gap: –1 • Vertical/Horiz. move: Score + (simple) gap penalty • Diagonal move: Score + match/mismatch score • Take the MAX of the three possibilities BLAST

  7. Fill-out rest of table • Fill out row-wise • Scoring • Match: +1 • Mismatch: 0 • Gap: –1 BLAST

  8. Fill-out rest of table • Fill out row-wise • Optimal alignment score in lower right hand corner BLAST

  9. Figure out alignment • Follow the source of “MAX” BLAST

  10. Alignment • = GAP in top sequence • = GAP in left sequence • = ALIGN both positions • One path from the previous table: • Corresponding alignment (start at the end):AC--TCG ACAGTAG BLAST

  11. Practice • Find an optimal alignment for these two sequences: GCGGTT GCGT • Match: +1 • Mismatch: 0 • Gap: –1 BLAST

  12. Practice • Find an optimal alignment for these two sequences: GCGGTT GCGT • Match: +1 • Mismatch: 0 • Gap: –1 GCGGTTGC-GT- Score = +2 BLAST

  13. Summary – pseudo code • F is the scoring matrix, S is a similarity matrix for determining match/mismatch penalties, A and B are the sequences, d is the gap penalty for i=0 to length, (A) F(i,0) ← d*i for j=0 to length(B) F(0,j) ← d*j for i=1 to length(A) for j = 1 to length(B) { Choice1 ← F(i-1,j-1) + S(A(i), B(j)) Choice2 ← F(i-1, j) + d Choice3 ← F(i, j-1) + d F(i,j) ← max(Choice1, Choice2, Choice3) } BLAST

  14. Once the F matrix is computed… AlignmentA ← "" AlignmentB ← "" i ← length(A) j ← length(B) while (i > 0 and j > 0){ Score ← F(i,j) ScoreDiag ← F(i - 1, j - 1) ScoreUp ← F(i, j - 1) ScoreLeft ← F(i - 1, j) if (Score == ScoreDiag + S(A(i-1), B(j-1))){ AlignmentA ← A(i-1) + AlignmentA AlignmentB ← B(j-1) + AlignmentB i ← i - 1 j ← j - 1 } else if(Score == ScoreLeft + d){ AlignmentA ← A(i-1) + AlignmentA AlignmentB ← "-" + AlignmentB i ← i - 1 } otherwise (Score == ScoreUp + d){ AlignmentA ← "-" + AlignmentA AlignmentB ← B(j-1) + AlignmentB j ← j - 1 } } while (i > 0){ AlignmentA ← A(i-1) + AlignmentA AlignmentB ← "-" + AlignmentB i ← i - 1 } while (j > 0){ AlignmentA ← "-" + AlignmentA AlignmentB ← B(j-1) + AlignmentB j ← j - 1 } BLAST

  15. What if one sequence was much longer? • If no penalty for gaps at ends will align optimally with internal sequences atgccgcatactgccgcaggagatcaggactttcatgaatatcatcatgcgtgggagttcag tgccgcaggagatcaggactttca BLAST

  16. Known as semi-global alignment • Global alignment means using the entirety of both sequences • Semi-global alignment allows gaps at the ends for free. • Initialize first row and column to all 0’s • Allow free horizontal/vertical moves in last row and column BLAST

  17. Local alignment • Local alignment – find the best matching subsequence CGATGAAATGGA • This is achieved by allowing a 4th alternative at each position in the table: zero. BLAST

  18. Local alignment • Smith-Waterman algorithm • No negatives • Match: +1 • Mismatch: -1 • Gap: -1 • Find max • Follow path till reach zero BLAST

  19. How complex? • Matrix is MxN • Now polynomial • Have gone from exponential to polynomial • Fixed: best • Linear: next best • Polynomial (n2): not bad • Exponential (3n): very bad O(n2) BLAST

  20. Is this good enough? • If use entire genome sequence as target and perform a local alignment • Genome is approximately 3 billion base-pares • If we have a database of the human genome • Somewhere around 35,000 genes • Would have to do 35,000 global alignments • Must do better! O(n2) not good enough BLAST

  21. Basic Local Alignment Search Tool • BLAST (Altschulet al. 1990) • Look for areas of interest (linear search) in large string (database) then align just those regions • Can move to near linear time complexity BLAST

  22. Algorithm • Use a sliding window to identify all words (length 3: for proteins or length 11: DNA) in query • Find all locations of these words in the database • Locations where find 2 matches within a certain distance are areas of interest • Align just these areas of interest atgagctatcgctgatgtaccat atgagctatcg tgagctatcgc And so on… gagctatcgct agctatcgctg BLAST

  23. How likely is an 11-mer match? • 411 = 4,194,304 so chance of a random hit: once every 4 million nt’s • Odds of a second hit a short distance away? • Drastically reduced alignment work Now all the way up to linear Fixed: best Linear: next best Polynomial (n2): not bad Exponential (3n): very bad BLAST

  24. What do you give-up? • Way faster (linear) but you miss some possibly important hits • What if there are not two contiguous identical stretches of nucleotides? Speed Sensitivity BLAST

  25. Next lesson… • How improve sensitivity • Also, what if have more than two sequences Sensitivity BLAST

  26. BLAST

  27. Bit Scores • Scores are affected by sequence lengths • If want scores that can be compared across different query lengths need to normalize • Term “bit” comes from fact that probabilities are stored as log2 values (binary, bit) • Done so can add across length of sequence instead of multiply BLAST

More Related