GENE EXPRESSION
GENE EXPRESSION. TRANSCRIPTION, TRANSLATION AND MUTATIONS. HOW DOES DNA, AS A GENE, GET EXPRESSED?. DNA codes for specific proteins to be made proteins are assembled from amino acids amino acids are selected based on the genetic code.
GENE EXPRESSION
E N D
Presentation Transcript
GENE EXPRESSION TRANSCRIPTION, TRANSLATION AND MUTATIONS
HOW DOES DNA, AS A GENE, GET EXPRESSED? • DNA codes for specific proteins to be made • proteins are assembled from amino acids • amino acids are selected based on the genetic code
Amino Acids will be bonded together to form long chains. These long chains are proteins. • There are 20 different amino acids • The DNA code dictates the sequence of acids
DNA to Proteins • The process of making the proteins from DNA instructions is called PROTEIN SYNTHESIS • Protein Synthesis has 2 major steps: • Transcription • Translation
TRANSCRIPTION Trans= Across Script= writing Writing across= RNA is being made (or written) using DNA Starts in the nucleus with the chromosome which contains the gene that will be expressed.
As with replication-- • DNA unzips, but this time only in the gene location • mRNA forms instead of another piece of DNA • Uracil is substituted for Thymine • only one strand is transcribed- called the “sense” strand- other strand is called the “nonsense” strand
WHAT IS A GENE? A gene is a section of a chromosome which codes for a specific trait
After the DNA code is copied into the mRNA language, Transcription ends with the mRNA leaving the nucleus. (DNA is too big)
RNA • needed to assist in the synthesis of proteins • 3 types • Messenger RNA (mRNA) • Transfer RNA (tRNA) • Ribosomal RNA (rRNA)
RNA STRUCTURE & Differences from DNA • 1.) Uracil instead of Thymine • 2.) Single stranded • 3.) Sugar is a Ribose Sugar
The strand of mRNA that forms is set up in 3-base code words. Formed from nitrogen bases These are called CODONS
Transcribe This DNA • DNA • ACTCAGACTATGACCTAGGATCAT • TGAGTCTGATACTGGATCCTAGTA • Consider bottom row as sense strand • What will the 8 codons be in mRNA?
TRANSLATION • Translating RNA into proteins • Where are proteins made?? • RIBOSOMES • Begins when mRNA travels to and enters the ribosomes • Transfer RNA (tRNA) is out in the cytoplasm searching for amino acids • Ribosomal RNA (rRNA) is in the ribosomes, helping place the mRNA in position
Each codon (mRNA) indicates which amino acid the tRNA is suppose to bring to the ribosomes. Scientists use a chart like this to translate the protein. Example: codon = ACA AA = threonine Fig. 14.11, p. 230
anticodon codon in mRNA anticodon amino acid attachment site amino acid OH tRNA MOLECULE amino acid attachment site Fig. 14.12, p. 231
C G anticodon 1 A U G anticodon 2 C C U anticodon 3 C G A anticodon 4 A G C anticodon 5 C U C anticodon 6 G A U anticodon 7 C Once mRNA is at the ribosome, tRNA matches amino acids to the codons using ANTICODONS **Each tRNA carries a different amino acid
Amino acid chain tRNA ribosome anticodon codons mRNA
Binding site for mRNA P (first binding site for tRNA) A (second binding site for tRNA) Fig. 14.14a, p. 232
Because there are only 20 amino acids, they are often called by their first three letters mRNA codons AUG CCG GAU UAG amino acids Met Pro Asp stop *not all codons will code for an AA, some will be stop codons to tell translation to stop start codon