dagan
Uploaded by
21 SLIDES
570 VUES
300LIKES

Short read mapping (Alignment)

DESCRIPTION

Short read mapping (Alignment). Alignment topics in GEN875. Whole genome alignment Short read “mapping” BLAST Pair-wise using dynamic programming Progressive multiple alignment. Alignment. Take a set of sequences. Find where they match.

1 / 21

Télécharger la présentation

Short read mapping (Alignment)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Short read mapping(Alignment)

  2. Alignment topics in GEN875 • Whole genome alignment • Short read “mapping” • BLAST • Pair-wise using dynamic programming • Progressive multiple alignment

  3. Alignment • Take a set of sequences. Find where they match. • Arrange sequences in a matrix where columns contain homologous (corresponding?) characters from each sequence

  4. Types of Alignments • Global – include the entire length of all sequences in the alignment • Local – identify and align subsets of longer sequences • Glocal - hybrid

  5. Short Read Mapping • Find a match between sequence reads and a reference genome • Find the best match between sequence reads and a reference genome • Find all the plausible matches between sequence reads and a reference genome

  6. Reads may not match the reference exactly • Sequence errors in the read – may be distinguishable using quality scores • Sequence errors in the reference genome • Legitimate polymorphism

  7. Phred Scores Phred Score P( incorrect base ) Base call accuracy 10 1 in 10 90% 20 1 in 100 99% 30 1 in 1000 99.9% 40 1 in 10000 99.99% 50 1 in 100000 99.999%

  8. @SEQ_ID GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT + !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Sanger format encodes a Phred quality score from 0 to 93 using ASCII 33 to 126 Illumina uses several variants

  9. When (how much) does (sequence and ) alignment accuracy matter? • RNA seq for expression • RNA seq for annotation – endpoints, splicing • chIP seq • Resequencing related genomes for SNP detection • Resequencing related genomes for indel detection • Resequencing to clean up existing sequences • Sequencing to determine copy number

  10. Short Read Mapping Tools • Bowtie • ELAND (Illumina) • Maq • SOAP • RMAP • ZOOM • SHRiMP • BFAST • MOSAIK • BWA • SOAP2 • Speed • Accuracy • Exact match vs mismatches • Gapped vs ungapped • Greedy or exhaustive

  11. Short Read Mapping Tools • Bowtie • ELAND (Illumina) • Maq • SOAP • RMAP • ZOOM • SHRiMP • BFAST • MOSAIK • BWA • SOAP2 • Hash table of oligos in reference sequence • Hash table of input reads • Hash table – method unknown • Burrows Wheeler Transform-based Index

  12. Spaced Seeds Example Seed: 1100 Query: GATC Matches: GATC GAAC GACC GATT GATA GATG • Length and weight of seeds • Number of Hash tables required to find mismatches

  13. Some mapping software uses alignment refinement • Once candidates are identified using the hash table search, conduct a more rigorous alignment of the read and reference genome • Smith-Waterman local alignment (with or without gaps)

  14. Bowtie • Burrows Wheeler Index based on FM index extended to accommodate mismatches • Reduces memory footprint • Increases speed • Amenable to multiple processors • 14 .3x Illumina coverage of human genome mapped in 14 hrs on a 4 core desktop PC

  15. Query Sequence: GGTA No exact match, so try alternative sequences with a mismatch: GGCA GGAA GGTG

  16. Bowtie caveat “If one or more exact matches exist for a read, then Bowtie is guaranteed to report one, but if the best match is an inexact one then Bowtie is not guaranteed in all cases to find the highest quality alignment.” …unless you use the slower “best” option

More Related