Understanding the Causes and Mechanisms of Genetic Mutations
This overview explores the various causes of genetic mutations, including spontaneous and induced mutations influenced by physical, chemical, and biological factors. It discusses how these mutations can affect different organs and cells, highlighting the agents responsible and the potential for protective measures and corrections. The mechanisms of mutation, such as DNA changes, base alterations, and epigenetic modifications, are examined along with the implications for gene expression and protein synthesis. This foundational knowledge is crucial in genetics and biotechnology applications.
Understanding the Causes and Mechanisms of Genetic Mutations
E N D
Presentation Transcript
WHAT CAUSES MUTATIONS? MUPGRET June 2004
OVERVIEW • Causes • Mechanisms • Life or Progeny? • Applications
CAUSES • Spontaneous/Chance • Induced • Physical • Chemical • Biological
INDUCED MUTATION • Physical: Radiation • Ultraviolet light • Ionizing: X-rays, Gamma rays • Chemical • Environmental agents • Exposures at work and play • Ethyl methane sulfonate, etc. • Biological • Transposable elements • Epigenetic changes
LIFE OR PROGENY? • What organ(s) are affected? • (skin, flesh, bone, liver, gonads, gametes) • By which agents? • How much is too much? • (organ vs. tissue vs. cell) • Are there protective measures? • Are there correctives? • Are there cures? • What probability applies? To whom?
MECHANISMS • DNA Changes • Base Changes • Additions, Subtractions • Insertions, Deletions, Transpositions • Chromosome and Genomic Changes • Epigenetic Changes • Methylation • Chromatin Structure
Allele • One of two to many alternative forms of the same gene (eg., round allele vs. wrinkled allele). • Alleles have different DNA sequences that cause the different appearances we see.
A Molecular View Parents F1 F2 Progeny WW ww Ww ¼WW ¼Ww ¼wW ¼ww 1: 2 : 1 Genotype = 3: 1 Phenotype
Round vs. wrinkled • The starch-branching enzyme (SBEI) defines the round vs. wrinkled phenotype. • Wrinkled peas result from absence of the branched form of starch called amylopectin. • Dried round peas with amylopectin shrink uniformly, and wrinkled do not.
DNA • Hereditary material. • Contains all information to make proteins. • Linear polymer of nucleotides. • Each nucleotide has sugar, phosphate and a base.
Four Bases • A=Adenine • T=Thymine • C=Cytosine • G=Guanine
How Does DNA Carry Information? • To answer this question we must take a closer look at DNA. • DNA is a biopolymer • Polymers are molecules made of repeating units or building blocks • DNA has four chemical building blocks symbolized by the letters A,G,C,& T • The letters of your DNA are in a specific order that carries information about you!! • So, a DNA polymer can be represented as a string of letters: A G C T T A G G G T A A A C C C A T A T A
DNA Carries Information in the Sequence of DNA Letters . . .A G C T T A G G G T A A A C C C A T A G . . . A gene • A gene is a length of DNA letters that contain • an instruction for a cell to follow. • The cell uses specially designed protein machines • to read the information in genes.
The Order of DNA Letters Encodes the Genetic Information The order orsequenceof the A, G, C and T letters in the DNA polymer encodes the actual genetic information • Example of the DNA letters in a gene: • AGCTTAGGGTAAACCATATAGGGCCATACCCTATCGGTAAGCTT • AGCTTAGGGAAAACCCATATAGGGCCATACCCTATCGGTAAG • The specific order of the DNA letters carries • the information. • Changing the order of the DNA letters will change the information carried by the gene. • We will talk about how this happens later!
Genes Contain Instructions for Building Proteins • Genes contain instructions for making proteins, one of the major types of the molecules of life, or “biomolecules” • Proteins, like DNA, are polymers • Protein building blocks are called amino acids • Amino acids are strung together into long, linear polymers by following the instructions in genes • In general, a gene encodes the instructions for one protein • When a gene is “misspelled,” the protein made from it • may be made with an incorrect amino acid • may not work properly
Gene Expression Pathway in Cells GENE DNA mRNA copy of gene mRNA goes to cytoplasm Ribosomes translate genetic information encoded in the mRNA into protein building blocks (chains of amino acids) Protein folds into 3D active structure Protein functions in cell Focus on the Genetic Code!
Genetic Code is Written in 3-Letter DNA Words (Codons) -TACCTCATGATTATACA- DNA(DNA strands separated) -AUGGAGUACUAAUAUGU mRNA (copied from DNA) 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA mRNA code “read” by ribosome in TANDEM triplets called codons. Codon adaptors convert RNA letters into the correct amino acid building blocks in the protein chain. • CODON MEANINGS: • A “START PROTEIN” SIGNAL:AUG • A “STOP PROTEIN” SIGNAL:UAA, UGA, UAG • An amino acid building blockof a protein • Codons identified in the Genetic Code Table
The Universal Genetic Code Table STOP Codons: UAA UAG UGA Name of Building Block Amino Acid: Phe=Phenylalanine Leu=Leucine Ile=Isoleucine AUG CODON: Signal to start making the protein. http://anx12.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_6.html
N Met Glu Tyr C Genetic Code is Written in 3-Letter DNA Words -TACCTCATGATTATACA- DNA STRAND AUGGAGUACUAAUAUGU mRNA copied from DNA 5’-AUGGAGUACUAAUAUGU mRNA 5’-AUG GAG UAC UAA UAU mRNA Met-Glu-Tyr-STOP mRNA code is “read” in TANDEM CODONS A SHORT PROTEIN IS A PEPTIDE • CODON MEANINGS: • “START PROTEIN HERE”:AUG (START) Methionine (Met) • “STOP PROTEIN HERE”:UAA, UGA, UAG • Amino acid building blocks:N-Met-Glu-Tyr-C • Codons are identified in the Genetic Code Table
One Gene-One Protein • Archibald Garrod (1902) described alkaptonuria, a hereditary disorder, as an “inborn error of metabolism”. • Proposed that mutations cause specific biochemical defects. • Alkaptonuria defect is dark urine.
Spelling Mistake The DNA “word” TTC is changed to TTT A DNA Spelling Mistake Can Alter the Protein Chain START ADD ADD ADD ADD ADD ADD ADD STOP ATG TTC AGG CCA AAT TTT GTC GCG UAA GGA ATT ATG TTT AGG CCA AAT TTT GTC GCG TTC to TTT spelling change causes a different protein building block to be inserted in the second position. That is all it takes. ADD = Codon specifies the amino acid specified by 3-letter “word” ATG/AUG = Codon specifies start and methionine (met) UAA = STOP adding amino acids to protein chain
A Mutation is a DNA “Spelling Mistake” • Mutant Genes Encode Defective Proteins: • (1)WILDTYPE(2)MUTANT • Example: AAA GCTACCTAT AAA GCTATCTAT • TTT CGATGGATA TTT CGATAGATA • Phe ArgTrp Ile Phe ArgStop • UAG • PROTEIN:WT FUNCTIONNO FUNCTION • (1) Normal DNA and amino acid sequence makes a wild-type protein. • (2) Mutation in DNA changesTrptoStop to make a short, mutant protein. • Mutations in DNA can be Caused by: • Mistakes made when the DNA is replicated (wrong base inserted) • Ultra violet (UV) light and ionizing radiation (X-rays) damage DNA • Environmental chemical carcinogens can damage DNA • Other factors DNA Technology: The Awesome Skill, I E Alcamo, Harcourt Academic Press, 2001
Cell may not be able to follow damaged instruction OR Damaged protein is made OR Spelling error may be harmless X X Damaged protein may or may not be able to function in the cell. Cell does not make the protein Functional protein made by the cell Misspelled Genes: 3 Possible Outcomes DNA A misspelled gene
Xeroderma pigmentosa • Autosomal recessive. • UV exposure damages DNA. • Defect in DNA damage repair. • Risks include cancer, telangiectasia, disfigurement. • Can be diagnosed before birth. • Take total protection measures from sun/fluorescent light.
UV damages tissue that contains molecules that can absorb light.
Mechanisms of UV damage • Low penetration into tissues. • Molecular fragmentation—proteins, enzymes, and nucleic acids contain double bonds that can be ruptured by UV. • Free radical generation—molecules of susceptible tissues absorb UV and eject an electron, which is taken up by oxygen, then termed superoxide, a free radical.
Free radicals • Are scavenged by superoxide dismutase, vitamin C, vitamin E, glutathione peroxidase, carotene.
Mutants across organisms • Sometimes mutations in the same gene in different organisms have similar phenotype. • This allows researchers to choose the organism with the best genetic resources to study the normal function of that gene. • This also allows researchers to identify prospective genes for a phenotype in one species, based on another.
Ionizing Radiation • Naturally occurring at low rate (cosmic rays; radium). • Deliberate or Accidental releases. • Isotopes decay at differing rates. • Elective exposures. • Health tests. • Treatments. • Occupational.
Mechanisms of Damage • Penetration depends on type (some shallow; some deep, no-tracks). • Ionizations, electron release. • Breakages, deletions, rearrangements.
Breakage on Purpose • Studies of development (cell proliferation and destiny). • Determination of cell-specific function.
Chemical Mutagens • Various; mixed mechanisms. • Interference with DNA replication. • Interference with cell proliferation. • Experimental mutagenesis. • Ethyl methane sulfonate (single-base changes; “Tilling”). • Others.
Biological Mutagens • Transpositions (internal or external). • Epigenetic changes (internal). • Methylation. • Chromatin structural changes.
Transposition on Purpose • Semi-controllable. • If the element is molecularly known, genes in which it is inserted may be cloned by “fishing”.
Epigenetic Events • Changes “occur” in predictable or unpredictable ways. • Methylation is one known cause. • Chromatin structural changes often accompany events.
MAIZE WORKSHOP 2004 Genetics, Genomics, and Bioinformatics March 7-11, 2004 Twenty-nine graduate students Eleven instructors Lecture notes and Exercises http://shrimp1.zool.iastate.edu/workshop/