170 likes | 362 Vues
From Gene to Protein : An exercise in breaking the code. New copy (RNA) is read and translated. Genes (DNA). Make copies of itself. www.squidoo.com/geneticsresearch. Amino acids (protein) are formed. A trait is expressed. VC: What is phenotype. Cracking the Code. DNA.
E N D
New copy (RNA) is read and translated Genes (DNA) Make copies of itself www.squidoo.com/geneticsresearch Amino acids (protein) are formed A trait is expressed VC: What is phenotype
Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN
DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides VC: DNA Replication VC: How DNA copies itself
A: TACCGGATGCCAGATCAAATCWhat is the other side?__________________________ Given the code of a DNA molecule, what would be the code of the new DNA strand? B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________
A: TACCGGATGCCAGATCAAATCWhat is the other side? Given the code of a DNA molecule, what would be the code of the new DNA strand? ATGGCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACTWhat is the other side?ATGCCCCCGCATTGGTGTTGA
2.CODE IS READ into RNA. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U to make RNA. From #1: (DNA copy) ATGGCCTACGGTCTAGTTTAG A: ____________________________________ B: ____________________________________
2.CODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U. ATGGCCTACGGTCTAGTTTAG A: ____________________________________ ATGCCCCCGCATTGGTGTTGA B: ____________________________________ AUGGCCUACGGUCUAGUUUAG AUGCCCCCGCAUUGGUGUUGA
3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). AUGGCCUACGGUCUAGUUUAG A: ____________________________________ B: ____________________________________
3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). AUGGCCUACGGUCUAGUUUAG A: ____________________________________ B: ____________________________________ AUG GCC UAC GGU CUA GUU UAG AUGCCCCCGCAUUGGUGUUGA AUG CCC CCG CAU UGG UGU UGA
Find the Amino Acid sequence that is coded: Use the following guide. AUG GCC UAC GGU CUA GUU UAG A: ____________________________________
AMINO ACID SEQUENCE AUG GCC UAC GGU A: Methionine-Alanine-Tyrosine-Glycine- CUA GUU UAG Leucine-Valine-Stop
AMINO ACID SEQUENCE AUG GCC UAC GGU CUA GUU UAG A: Methionine-Alanine-Tyrosine-Glycine- Leucine-Valine-Stop B: Methionine-Proline-Proline-Histidine- Tryptophan-Cysteine-Stop AUG CCC CCG CAU UGG UGU UGA
Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN
New copy (RNA) is read and translated Genes(DNA) Make copies of itself Crossover (mixing of code) www.squidoo.com/geneticsresearch Amino acids (protein) are formed A trait is expressed VC: What is phenotype