1 / 32

A Note on Useful Algorithmic Strategies

A Note on Useful Algorithmic Strategies. Kun-Mao Chao ( 趙坤茂 ) Department of Computer Science and Information Engineering National Taiwan University, Taiwan WWW: http://www.csie.ntu.edu.tw/~kmchao. Greedy Algorithm. A greedy method always makes a locally optimal (greedy) choice.

dbetts
Télécharger la présentation

A Note on Useful Algorithmic Strategies

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A Note on Useful Algorithmic Strategies Kun-Mao Chao (趙坤茂) Department of Computer Science and Information Engineering National Taiwan University, Taiwan WWW: http://www.csie.ntu.edu.tw/~kmchao

  2. Greedy Algorithm • A greedy method always makes a locally optimal (greedy) choice. • the greedy-choice property: a globally optimal solution can be reached by a greedy choice. • optimal substructures

  3. Huffman Codes (1952) David Huffman (August 9, 1925 – October 7, 1999)

  4. Huffman Codes Expected number of bits per character = 3x0.1+3x0.1+2x0.3+1x0.5 = 1.7 (vs. 2 bits by a simple scheme)

  5. An example Sequence: GTTGTTATCGTTTATGTGGC By Huffman Coding: 0111011100010010111100010110101001 20 characters; 34 bits in total

  6. Divide-and-Conquer • Divide the problem into smaller subproblems. • Conquer each subproblem recursively. • Combine the solutions to the child subproblems into the solution for the parent problem.

  7. Merge Sort(Invented in 1938; Coded in 1945) John von Neumann (December 28, 1903 – February 8, 1957 )

  8. Merge Sort(Merge two solutions into one.)

  9. Merge Sort

  10. Dynamic Programming • Dynamic programming is a class of solution methods for solving sequential decision problems with a compositional cost structure. • Richard Bellman was one of the principal founders of this approach. Richard Ernest Bellman(1920–1984)

  11. Two key ingredients • Two key ingredients for an optimization problem to be suitable for a dynamic-programming solution: 2. overlapping subproblems 1. optimal substructures Subproblems are dependent. (otherwise, a divide-and-conquer approach is the choice.) Each substructure is optimal. (Principle of optimality)

  12. Three basic components • The development of a dynamic-programming algorithm has three basic components: • The recurrence relation (for defining the value of an optimal solution); • The tabular computation (for computing the value of an optimal solution); • The traceback (for delivering an optimal solution).

  13. = F 0 0 = F 1 1 = + F F F for i>1 . - - i i 1 i 2 Fibonacci numbers The Fibonacci numbers are defined by the following recurrence: Leonardo of Pisa(c. 1170 – c. 1250) 0, 1, 1, 2, 3, 5, 8, 13, 21, 34, 55, 89, 144, 233, 377, 610, 987, 1597, 2584, 4181, 6765, 10946, 17711, 28657, 46368, 75025, 121393, ...

  14. F8 F9 F7 F10 F7 F8 F6 How to computeF10？ ……

  15. Tabular computation • The tabular computation can avoid recompuation.

  16. Longest increasing subsequence(LIS) • A subsequence of a sequence S is obtained by deleting zero or more numbers from S. The longest increasing subsequence problem is to find a longest increasing subsequence of a given sequence of distinct integers a1a2…an. • e.g. 9 2 5 3 7 11 8 10 13 6 • 3 7 • 7 10 13 • 7 11 • 3 5 11 13 are increasing subsequences. We want to find a longest one. are not increasing subsequences.

  17. A naive approach for LIS • Let L[i] be the length of a longest increasing subsequence ending at position i. L[i] = 1 + max j = 0..i-1{L[j] | aj < ai}(use a dummy a0 = minimum, and L[0]=0) 9 2 5 3 7 11 8 10 13 6 L[i] 1 1 2 2 3 4 ?

  18. A naive approach for LIS L[i] = 1 + max j = 0..i-1{L[j] | aj < ai} 9 2 5 3 7 11 8 10 13 6 L[i] 1 1 2 2 3 4 4 5 6 3 The maximum length The subsequence 2, 3, 7, 8, 10, 13 is a longest increasing subsequence. This method runs in O(n2) time.

  19. An O(n log n) method for LIS • Define BestEnd[k] to be the smallest number of an increasing subsequence of length k. 9 2 5 3 7 11 8 10 13 6 9 2 2 2 2 2 2 2 2 BestEnd[1] 5 3 3 3 3 3 3 BestEnd[2] 7 7 7 7 7 BestEnd[3] When processing ai, let BestEnd[k’]be the smallest element that is larger than ai. BestEnd[k’] ai 11 8 8 8 BestEnd[4] 10 10 BestEnd[5] 13 BestEnd[6]

  20. An O(n log n) method for LIS • Define BestEnd[k] to be the smallest number of an increasing subsequence of length k. 9 2 5 3 7 11 8 10 13 6 9 2 2 2 2 2 2 2 2 2 BestEnd[1] 5 3 3 3 3 3 3 3 BestEnd[2] 7 7 7 7 7 6 BestEnd[3] 11 8 8 8 8 BestEnd[4] 10 10 10 BestEnd[5] For each position, we perform a binary search to update BestEnd. Therefore, the running time is O(n log n). 13 13 BestEnd[6] The subsequence 2, 3, 7, 8, 10, 13 is a longest increasing subsequence.

  21. Binary search • Given an ordered sequence x1x2 ... xn, where x1<x2< ... <xn, and a number y, a binary search finds the largest xi such that xi< y in O(log n) time. n/2 ... n/4 n

  22. Binary search • How many steps would a binary search reduce the problem size to 1?n n/2 n/4 n/8 n/16 ... 1 How many steps? O(log n) steps.

  23. All longest increasing subsequences • The number of all longest increasing subsequences could be exponential. 1 5 4 3 2 6 10 9 8 7 11 15 14 13 12 16 20 19 18 17 21 1 5 4 3 2 6 10 9 8 7 11 15 14 13 12 16 20 19 18 17 21 There are 4 x 4 x 4 x 4 = 256 longest increasing subsequences.

  24. Longest Common Subsequence (LCS) • A subsequence of a sequence S is obtained by deleting zero or more symbols from S. For example, the following are all subsequences of “president”: pred, sdn, predent. • The longest common subsequence problem is to find a maximum-length common subsequence between two sequences.

  25. LCS For instance, Sequence 1: president Sequence 2: providence Its LCS is priden. president providence

  26. LCS Another example: Sequence 1: algorithm Sequence 2: alignment One of its LCS is algm. a l g o r i t h m a l i g n m e n t

  27. How to compute LCS? • Let A=a1a2…am and B=b1b2…bn . • len(i, j): the length of an LCS between a1a2…ai and b1b2…bj • With proper initializations, len(i, j)can be computed as follows.

  28. Longest Common Increasing Subsequence • Proposed by Yang, Huang and Chao • IPL 2005 • 2 5 3 7 11 8 10 13 6 6 5 2 8 3 7 4 10 1 13

More Related