della
Uploaded by
22 SLIDES
314 VUES
220LIKES

Hydrophobic Interactions in AlsN Protein of Candida albicans Explored Through Experimental Design

DESCRIPTION

This research by Augusto Cigliano at California State University Long Beach delves into the role of AlsN protein in adhesion events, focusing on hydrophobic interactions that influence epithelial cell binding. The study involves mutating regions of the AlsN gene to investigate the impact on adhesion properties, utilizing innovative methods like hydrophobic microsphere assay. The findings shed light on the significance of hydrophobicity in protein adhesion and suggest potential avenues for further exploration in this field.

1 / 22

Télécharger la présentation

Hydrophobic Interactions in AlsN Protein of Candida albicans Explored Through Experimental Design

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Hydrophobic interactions in the N-terminal of Alsn protein of Canidada albicans are responsible for epithelial adhesion events when the protein is expressed in Saccromyces cerevisiae By Augusto Cigliano: Undergraduate Research Assistant for Dr. Zhang at California State University Long Beach

  2. Lecture Outline • General background information • Talk about motivations for this experiment • The experimental design • Specific methods and their results • Problems with testing hydrophobicity • Conclusions • Future experiments

  3. Background information • Candida albicans is an opportunistic pathogen that has a diverse range of associations with its host. (yeast infection?) • If adhesion to host cells is the first step on the road to C.albicans pathogenesis, blocking this first step could stop its pathogenesis, and save lives. This would be simple, accept evolution has given this little guy lots of different proteins to use to adhere to its host. • Numerous studies were done on the sexual agglutinin proteins of Saccromyces cerevisiae, a yeast that does not adhere to human cells. • Scientists blasted the agglutinin gene sequence into the C. albicans known geneome and came up with numerous close matches, now called agglutinin-like sequences (Als). • The different Als proteins are coded for on different loci, but they all similar 3-domain structure with a highly conserved N-terminus • The N-terminal is believed to give the protein its binding properties

  4. This experiment • Recent studies have uncovered yet another Als protein: Alsn. What role does it play in cell adhesion? What causes it to adhere? How is it different from the other Als proteins? • What is known is that it binds weakly to endothelial cells and is the least conserved of all the proteins in the Als family. It also has fewer hydrophobic sequences than all the other Als proteins. • Could this decrease in hydrophobicity be the cause in its weak adherence to endothelial cells? • This experiment shows that hydrophobicity could be the main cause for the aherence of Alsn protein in vitro. • Studying the mechanisms by which this protein adheres might give a clue to how the other proteins in this same family adhere.

  5. The experimental design Using PCR technology, I mutated the areas of the Alsn C. albicans gene involved in hydrophobic interactions with host cells. Then, I expressed the gene into a normally nonadherent S. cerevisiae yeast using a shuttle vector. Using immunostaining, I made sure the protein was being expressed on the surface of the yeast cell. I assayed for adherence to epithelial cells Finally I used a hydrophobic microsphere assay to double checked to make sure the mutations of the hydrophobic regions resulted in actual decrease in the cells hydrophobic character.

  6. Amino acids 350-365 and 690-706 Expected areas involved in hydrophobic interactions. N-terminus of Alsn protein Three mutations were constructed. M1 mutated regions 350 to 365, M2 mutated regions 690 to 706, and M3 combined both mutations.

  7. SacII Xho1 N-terminus of ALSn Introduction of Point Mutations through Sequential PCR Steps The plasmid is made by cutting out the N-terminus with Xho1 and SacII restriction sites, and subcloning into a high copy number vector.

  8. Xho1 SacII Xho1 SacII From here, the N-terminus was amplified for 25 cycles with the two sets of primers. F=forward primer R=reverse primer M= mutated primers Primers 5 and 6 were synthesized with mutations, while F and R were synthesized for the end sequences to include restriction sites Xho 1 and SacII respectively.

  9. Example of a synthesized primer Hydrophobic coding region PRIMER 5 5’TATCATCAGCAGGATAATAACAGTCAACAGAGCTTTTCCCTTTATCATCAGETC 3’ 5’ CCCCGACTACTAGATGCTCCCT TTAT CATCAGCAGGATATTATCGGTCTACTGGGCTTTTCCCTTTATCATCAGCAG 3’ 3’ GGGGCTGATGATCTACGAGGGAAATAGTAGTCGTCCTA TAATAGCCAGATGACCCGAAAAGGGAAATAGTAGTCGTC 5’ 3’ETCTCTACGAGGGAAATAGTAGTCGTCCTATTATT GTCA GTTGTCTCGAAAAGGGAAATAGTAG5’ The specific sequences for hydrophobic amino acids found on the surface of the Alsn protein were manipulated to code for polar amino acids. PRIMER 6 ~Ile-Ile-Gly-Leu-Leu-Gly~ now reads ~Asn-Asn-Ser-Gln-Gln-Ser~

  10. The Amplified DNA was obtained and put through one cycle with no Forward and reverse primers. Mutated Primers Xho1 SacII

  11. . SacII Xho1 ALSn This vector is a shuttle vector that passes freely from E.coli into S. cerevisie The N-terminal with SacII restriction site specific for its own gene (that has the N-terminus missing) and XhoI site for the lambda-YES shuttle vector, should insert itself into the Alsn gene and the vector. Run on a gel to ensure the gene has been inserted.

  12. Alsn expression in S. cerevisiae • S. cerevisiae ura- yeast were transformed with lambda-YES Alsn mutants and controls. • The Ura+ mutants were selected for as being transformed and were colony-purified. • The mutant yeast were grown in a galactose containing minimal medium to induce expression of the Alsn protein. The lambda-YES vector’s promoter region is galactose induced.

  13. Preventing false negatives • Did the Alsn proteins even make it to the yeast’s surface. If they didn’t, I would be getting false negatives! • Surface proteins were detected with immunostaining: polyclonal antibodies were added, then washed. • Goat-anti-rabbit-FITC was added, incubated, then washed. • Any polyclonal antibodies that initially adhered would attach the labeled secondary antibodies. • If fluorescence is visualized, the Alsn protein is being expressed on the membrane’s surface.

  14. Assay for Adherence to epithelial cells • Each strain was tested for adherence to epithelial cells using a standard adherence assay and the percent adherence was calculated by actually counting the adhered cells microscopically and using the formula (CFUs per well/total input cells)*100.

  15. E E E E This graph depicts the % binding of C. albicans ALSn protein expressed S. cervisiae yeast to epithelial cells. The positive control is S. cervisiae with both surface N-terminal hydrophobic sections intact. Negative control shows yeast with an empty vector. The mutant one (M1) has one hydrophobic section mutated. Mutant two (M2) has the other hydrophobic section mutated. Mutant three (M3) has both sections mutated. The yellow arms represent how the hydrophobic sections grab onto the red epithelial cells. The sad M3 mutant has no arms and has a hard time adhering.

  16. Determining Hydrophobicity • A hydrophobic microsphere test was done in addition to the epithelial adhesion assay to assess whether the mutant Alsn proteins are less hydrophobic than the normal Alsn proteins. • Microspheres are very small polystyrene hydrophobic beads. In essence, they are mixed in with the cells and bind to its hydrophobic parts. • The % of cells which are hydrophobic was determined from bright-field microscopy (a method for illuminating the beads). A count of 100 cells containing 3 or more attached microspheres determined the hydrophobicity of each population. The difference of the cell surface adhesion (CSH) value from 100% determines the hydrophobic level of each population.

  17. Things get complicated! Selection of optimal microsphere size As can be seen in the graph, the smaller the hydrophobic pellet, the more hydrophobicity is expressed in both the + and - controls.This is because the small pellets get into the grooves of all folded proteins and adhere. If the pellets are too large, there will be no adhesion. If we assume that the Alsn protein folds in such a way as to offer up its N-terminus so that the hydrophobic region is positioned for adhesion, we can find a bead that is big enough not to adhere proteins native to S. cerevisiae, yet will still adhere to the Alsn protein. This bead is 1.0um in diameter. Using this size bead, we can now say that proteins hydrophobicity was altered by the mutations. Of course another separate test needs to be made to validate the statement that the Alsn’s hydrophobicity is even affected by the mutations to the hydrophobic region. The level of hydrophobicity expressed by a protein and the number of hydrophobic amino acids it has do not go hand and hand and so hydrophobicity can not be calculated based on structure. The question is are the protein’s hydrophobic sections available for a yeast-host cell interaction? A simple hydrophobicity test for the isolated protein will not work. The protein needs to be properly folded, processed and glycosilated, and expressed on the cells surface. Even though S. cerevisiae cells do not show adherence, they do express “hidden” hydrophobicity.

  18. So what do we gather from this experiment? • N-terminal hydrophobic residues 350 to 365 and 690 to 706 are mainly responsible for Alsn adhesion. • Mutations of these hydrophobic residues that made them expessess polar residues decreased cellular adhesion in vitro and also showed a decrease in hydrophobicity. • We can conclude that nonspecific hydrophobic interactions are probably the main cause of the Alsn binding character.

  19. Looking at my results and drawing conclusions • What about the possibility that there is another mechanism that was affected by the mutations? • This is probably unlikely because the loss of hydrophobicity was proportional to the loss of adhesion events. • If hydrophobicity was decreased and adhesion events remained the same, then there would probably be another mechanism associated. • If hydrophobicity wasn’t affected by the mutation, then something went wrong in the design of my experiment, or my detection of hydrophobicity was not accurate.

  20. In conclusion • Whether or not these nonspecific interactions are the cause of cellular adhesion events in other proteins of the Als family is still an area of research. • A more broad question is why do C. albicans have such diversity? If the majority of cellular adhesion events are believed to be caused by other surface proteins such as mannoproteins and C3d-Binding proteins, why do the Alsn proteins exist? (Survival?) • The main goal of this and similar research is the identification and characterization of any and all proteins believed to be involved in adhesion. Continue research along these lines. • Who knows to what extent this knowledge will be useful in combating future diseases.

  21. Future experiments • Because the Alsn protein is so new, we need more basic experiments to characterize its functional domains (this is being done right now at UCLA.) • What causes the C. albicans cells to express any one of the C. albicansAls proteins in humans? Set up experiments that mimic diferent enviornmental conditions found in the the human body. • See if adhesion of this protein is linked to pathogenesis of the C. albicans Alsn protein. This is a hard experiment because adherence and pathogenesis is already known to be mediated by many other adhesion proteins. But to what extent does Alsn participate C. albicans adhesion? Determining its roll in pathogenesis is tricky because you have to work with animals.

  22. Acknowledgments • The Howard Hughes institute • Dr. Zhang • Department of Microbiology CSULB • Natalie Lucindo • Dr. Mason and Dr. Archie • my biology 490 instructors at CSULB.

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer