html5-img
1 / 42

Introduction to BLAST

Introduction to BLAST. David Fristrom Bibliographer/Librarian Science and Engineering Library fristrom@bu.edu 617 358-4124. What is BLAST?. Free, online service from National Center for Biotechnology Information (NCBI). http://blast.ncbi.nlm.nih.gov/Blast.cgi. What is BLAST?. as

demetra
Télécharger la présentation

Introduction to BLAST

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Introduction to BLAST David Fristrom Bibliographer/Librarian Science and Engineering Library fristrom@bu.edu 617 358-4124

  2. What is BLAST? Free, online service from National Center for Biotechnology Information (NCBI) http://blast.ncbi.nlm.nih.gov/Blast.cgi

  3. What is BLAST? as Google : Internet BLAST : Nucleotide/Protein Sequence Databases

  4. Some Uses for BLAST • Identify an unknown sequence • Build a homology tree for a protein • Get clues about protein structure by finding similar proteins with known structures • Map a sequence in a genome • Etc., etc.

  5. What is BLAST? Basic Local Alignment Search Tool

  6. Alignment AACGTTTCCAGTCCAAATAGCTAGGC ===--=== =-===-==-====== AACCGTTC TACAATTACCTAGGC Hits(+1): 18 Misses (-2): 5 Gaps (existence -2, extension -1): 1 Length: 3 Score = 18 * 1 + 5 * (-2) – 2 – 2 = 6

  7. Global Alignment • Compares total length of two sequences • Needleman, S.B. and Wunsch, C.D. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol. 48(3):443-53(1970).

  8. Local Alignment • Compares segments of sequences • Finds cases when one sequence is a part of another sequence, or they only match in parts. • Smith, T.F. and Waterman, M.S. Identification of common molecular subsequences. J Mol Biol. 147(1):195-7 (1981)

  9. Search Tool • By aligning query sequence against all sequences in a database, alignment can be used to search database for similar sequences • But alignment algorithms are slow

  10. What is BLAST? • Quick, heuristic alignment algorithm • Divides query sequence into short words, and initially only looks for (exact) matches of these words, then tries extending alignment. • Much faster, but can miss some alignments • Altschul, S.F. et al. Basic local alignment search tool. J Mol Biol. 215(3):403-10(1990).

  11. What is BLAST? • BLAST is not Google • BLAST is like doing an experiment: to get good, meaningful results, you need to optimize the experimental conditions

  12. Sample Search • Human beta globin (HBB) • Subunit of hemoglobin • Acquisition number: NP_000509 • Limit to mouse to more easily show differences between searches

  13. Interpreting Results • Score: Normalized score of alignment (substitution matrix and gap penalty). Can be compared across searches • Max score: Score of single best aligned sequence • Total score: Sum of scores of all aligned sequences

  14. Interpreting Results • Query coverage: What percent of query sequence is aligned • E Value: Number of matches with same score expected by chance. For low values, equal to p, the probability of a random alignment • Typically, E < .05 is required to be considered significant

  15. Getting the most out of BLAST • What kind of BLAST? • Pick an appropriate database • Pick the right algorithm • Choose parameters

  16. Step 0: Do you need to use BLAST?

  17. Step 1:Nucleotide BLAST vs. protein BLAST • Largely determined by your query sequence BUT • If your nucleotide sequence can be translated to a peptide sequence, you probably want to do it (use tool such as ExPASy Translate Tool) • Protein blasts are more sensitive and biologically significant • Sometimes it makes sense to use other blasts

  18. Specialized Search: blastx • Search protein database using a translated nucleotide query • Use to find homologous proteins to a nucleotide coding region • Translates the query sequence in all six reading frames  • Often the first analysis performed with a newly determined nucleotide sequence http://www.ncbi.nlm.nih.gov/blast/producttable.shtml#blastx

  19. Specialized Search: tblastn • Search translated nucleotide database using a protein query • Does six-frame translations of the nucleotide database • Find homologous protein coding regions in unannotated nucleotide sequences such as expressed sequence tags (ESTs) and draft genome records (HTG) http://www.ncbi.nlm.nih.gov/blast/producttable.shtml#tblastn

  20. Specialized Search: tblastx • Search translated nucleotide database using a translated nucleotide query • Both translations use all six frames • Useful in identifying potential proteins encoded by single pass read ESTs • Good tool for identifying novel genes • Computationally intensive   http://www.ncbi.nlm.nih.gov/blast/producttable.shtml#tblastx

  21. Even More Specialized • Make specific primers with Primer-BLAST • Search trace archives • Find conserved domains in your sequence (cds) • Find sequences with similar conserved domain architecture (cdart) • Search sequences that have gene expression profiles (GEO) • Search immunoglobulins (IgBLAST) • Search for SNPs (snp) • Screen sequence for vector contamination (vecscreen) • Align two (or more) sequences using BLAST (bl2seq) • Search protein or nucleotide targets in PubChem BioAssay • Search SRA transcript libraries • Constraint Based Protein Multiple Alignment Tool

  22. Step 2: Choose a Database • Too large: • Takes longer • Too many results • More random, meaningless matches • Too small or wrong one: • Miss significant matches

  23. Protein Databases • Non-redundant protein sequences (nr) • Kitchen-sink: • Translations of GenBank coding sequences (CDS) • RefSeq Proteins • PDB (RCSB Protein Data Bank - 3d-structure) • SwissProt • Protein Information Resource (PIR) • Protein Research Foundation (Japanese DB) • Reference proteins (refseq_protein) • NCBI Reference Sequences: Comprehensive, integrated, non-redundant, well-annotated set of sequences • Swissprot protein sequences (swissprot) • Swiss-Prot: European protein database (no incremental updates)

  24. Protein Databases • Patented protein sequences (pat) • Patented sequences • Protein Data Bank proteins (pdb) • Sequences from RCSB Protein Data Bank with experimentally determined structures • Environmental samples (env_nr) • Protein sequences from environmental samples (not associated with known organism)

  25. Nucleotide Databases • Human genomic + transcript • http://www.ncbi.nlm.nih.gov/genome/guide/human/ • Mouse genomic + transcript • http://www.ncbi.nlm.nih.gov/genome/guide/mouse/ • Nucleotide collection (nr/nt) • “nr” stands for “non-redundant,” but it isn’t • GenBank (NCBI) • EMBL (European Nucleotide Sequence Database) • DDBJ (DNA Databank of Japan) • PDB (RCSB Protein Data Bank - 3d-structure) • Kitchen sink but not HTGS0,1,2, EST, GSS, STS, PAT, WGS

  26. Nucleotide Databases • Reference mRNA sequences (refseq_rna) • Reference genomic sequences (refseq_genomic) • NCBI Reference Sequences: Comprehensive, integrated, non-redundant, well-annotated set of sequences • NCBI Genomes (chromosome) • Complete genomes and chromosomes from Reference Sequences

  27. Nucleotide Databases • Expressed sequence tags (est) • Non-human, non-mouse ESTs (est_others) • http://www.ncbi.nlm.nih.gov/About/primer/est.html • http://www.ncbi.nlm.nih.gov/dbEST/index.html • Genomic survey sequences (gss) • Like EST, but genomic rather than cDNA (mRNA) • random "single pass read" genome survey sequences. • cosmid/BAC/YAC end sequences • exon trapped genomic sequences • Alu PCR sequences • transposon-tagged sequences • http://www.ncbi.nlm.nih.gov/dbGSS/index.html

  28. Nucleotide Databases • High throughput genomic sequences (HTGS) • Unfinished sequences (phase 1-2). Finished are already in nr/nt • http://www.ncbi.nlm.nih.gov/HTGS/ • Patent sequences (pat) • Patented genes • Protein Data Bank (pdb) • Sequences from RCSB Protein Data Bank with experimentally determined structures • http://www.rcsb.org/pdb/home/home.do

  29. Nucleotide Databases • Human ALU repeat elements (alu_repeats) • Database of repetitive elements • Sequence tagged sites (dbsts) • Short sequences with known locations from GenBank, EMBL, DDBJ • Whole-genome shotgun reads (wgs) • http://www.ncbi.nlm.nih.gov/Genbank/wgs.html

  30. Nucleotide Databases • Environmental samples (env_nt) • Nucleotide sequences from environmental samples (not associated with known organism)

  31. Database Options • Limit to (or exclude) an organism • Exclude Models (XM/XP) •  Model reference sequences produced by NCBI's Genome Annotation project. These records represent the transcripts and proteins that are annotated on the NCBI Contigs … which may have been generated from incomplete data. • Entrez Query • Use Entrez query syntax to limit search

  32. Step 3:Choose an Algorithm • How close a match are you looking for? • Determines how similarities are “scored” • Affects speed of search and chance of missing match • Again, what is the goal of the search?

  33. blastp • Protein-protein BLAST • Standard protein BLAST

  34. PSI-BLAST • Protein-protein BLAST • Position-Specific Iterated BLAST • Finds more distantly related matches • Iterates: Initial search results provide information on “allowed” mutations; subsequent searches use these to create custom substitution matrix

  35. PHI-BLAST • Protein-protein BLAST • Pattern Hit Initiated BLAST • Variation of PSI-BLAST • Specify a pattern that hits must match • Use when you know protein family has a signature pattern: active site, structural domain, etc. • Better chance of eliminating false positives • Example: VKAHGKKV

  36. megablast • Nucleotide BLAST • Finds highly similar sequences • Very fast • Use to identify a nucleotide sequence

  37. blastn • Nucleotide BLAST • Use to find less similar sequences

  38. discontiguous megablast • Nucleotide BLAST • Bioinformatics. 2002 Mar;18(3):440-5. PatternHunter: faster and more sensitive homology search. Ma B, Tromp J, Li M. • Even more dissimilar sequences • Use to find diverged sequences (possible homologies) from different organisms

  39. Step: 4Algorithm Parameters Fine-tune the algorithm • Short Queries • Expect threshold: The lower it is, the fewer false positives (but you might miss real hits)

  40. Algorithm Parameters Scoring Matrix: • PAM: Accepted Point Mutation • Empirically derived chance a substitution will be accepted, based on closely related proteins • Higher PAM numbers correspond to greater evolutionary distance • BLOSUM: Blacks Substitution Matrix • Another empirically derived matrix, based on more distantly related proteins • Lower BLOSUM numbers correspond to greater evolutionary distance • Compositional adjustment changes matrix to take into account overall composition of sequence

  41. Algorithm Parameters Filters and Masking • Can ignore low complexity regions in searching

  42. Additional Sources • Pevsner, Jonathan Bioinformatics and Functional Genomics, 2nd ed. (Wiley-Blackwell, 2009) • BLAST help pages: http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs • Slides from class on similarity searching; lots of technical details on algorithms and similarity matrices: http://www.ncbi.nlm.nih.gov/Class/NAWBIS/Modules/Similarity/simsrchlast.html

More Related