1 / 58

WormBase: A Resource for the Biology & Genome of C. elegans

WormBase: A Resource for the Biology & Genome of C. elegans. Lincoln D. Stein. WormBase Web Site. WormBase is a MOD. Model Organism Database Repository for reagents Genetic stocks, vectors, clones Genetic maps Large-scale data sets Genome, EST sets, microarrays, interactions Literature

dena
Télécharger la présentation

WormBase: A Resource for the Biology & Genome of C. elegans

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. WormBase: A Resource for the Biology & Genome of C. elegans Lincoln D. Stein

  2. WormBase Web Site

  3. WormBase is a MOD • Model Organism Database • Repository for reagents • Genetic stocks, vectors, clones • Genetic maps • Large-scale data sets • Genome, EST sets, microarrays, interactions • Literature • Meetings, announcements, etc

  4. Other MODs • FlyBase (Drosophila) • WormBase (Caenorhabditis) • SGD (Saccharomyces) • TAIR (Arabidopsis) • MGD (Mus) • PlasmoDB (Plasmodium) • RatDB (Rattus)

  5. C. elegans FunFacts • 1.5 mm length • 2 week life span • 959 cells • 302 neurons • 6 chromosomes • 100,258,171 bp (95 Ns) • 19,000 genes • 2,000 mutant strains

  6. WormBase FunFacts • 402,076 Sequences • 121,671 Proteins • 143,708 Clones • 24,728 Primer pairs • 15,022 Papers • 12,552 Loci • 2,944 Cells • 14 Maps • 7,200 RNAi results • 332 Transgenes • 19,713 Expression Patterns

  7. WormBase Tour: Looking for MAP Kinase Kinase

  8. mek-2 RNAi Studies Found a Genetic Locus: mek-2 mek-2 Phenotype & Expr Pattern

  9. mek-2 RNAi Phenotype

  10. mek-2 Sequence View

  11. mek-2 Protein View

  12. mek-2 Genome View

  13. mek-2 PCR Assays

  14. mek-2 Bibliography

  15. mek-2 Citation

  16. VB1 Neuron

  17. VB1 Synapses

  18. VBx Neuroanatomy

  19. Advanced Searches (1)

  20. Advanced Searches (2)

  21. Advanced Searches (3)

  22. Ad Hoc Queries

  23. Bulk FTP Downloads • Genomic sequence • DNA (fasta) • Feature files (GFF) • C. briggsae DNA • ESTs (fasta) • WormPep • Non-coding RNAs • All the software (Open Source)

  24. Recently Added: C. briggsae • C. elegans sequencing consortium (WashU + Sanger Center) • Whole genome shotgun + 12 Mb previously-finished BACs from WashU • 142 scaffolds • N50= 1,450 kb • 21,000 predicted genes • 11,000 genes orthologous to elegans

  25. Accessing briggsae via elegans Corresponding region in briggsae

  26. Synteny/Orthology Display

  27. WormBase Usage

  28. WormBase Hits by Domain

  29. Major Referrers

  30. Top Pages

  31. How WormBase Works Web server Images, Movies Perl scripts You Database access library Genomic Data ACeDB MySQL

  32. .ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC

  33. .ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC Sanger

  34. .ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC Sanger CSHL www.wormbase.org

  35. .ace .ace .ace .ace .ace WormBase Information Workflow CalTech Sanger WashU NCBI CGC Sanger CalTech Caltech.wormbase.org CSHL www.wormbase.org

  36. Curating a Paper Clipping Service Domain Expert Gene Record Database Entry Cell Record Mutant Record CalTechAce .ACE Files .ACE File

  37. Curating the Genome (1) >CHROMOSOME_I gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagc ctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcct aagcctaagcctaagcctaagcctaagcctaagcctaagcctaagcctaa gcctaag… Gene Prediction Repeat Finding EST Alignment List of Features

  38. Curating the Genome (2) List of Features CamAce StlAce ACeDB Sequence Editor

  39. CSHLAce Curating Other Data Sets GO Consortium Knockout Consortium RNAi Labs C. elegans Microarray Consortium ORFeome Project

  40. Build Process CSHLAce StlAce CalTechAce CamAce integrate reconcile BuildAce WormBase

  41. The GMOD Project • Generic Model Organism Database • Generic MOD web site • Database schemas • Standard operating procedures • Annotation tools • Analysis tools • Visualization tools http://www.gmod.org

  42. Released Modules • Apollo genome annotation editor • GBrowse generic genome browser • PubSearch literature curation system • LabDoc SOP editor • CMap comparative map viewer • GOET ontology editor • Chado modular database schema

  43. GBrowse

  44. Zoomed Way In

  45. Zoomed Way Way In

  46. Zoomed Way Way Out

  47. Keyword Search

  48. Sequence Search

  49. Third Party Annotations

  50. Links to 3d Party Web Sites

More Related