1 / 1

SCO4251

D bldA 1. D bldA 1. D bldA 1. D bldA 1. M600 1. M600 1. M600 1. M600 1. M600 2. M600 2. M600 2. M600 2. D bldA 2. D bldA 2. D bldA 2. D bldA 2. D. D 4263. M600. E S. E S. 4251. 4252. 4253. SCO 0762. SCO 4253. SCO4252, 4253 and 4262. SCO4246 and 4256.

Télécharger la présentation

SCO4251

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DbldA 1 DbldA 1 DbldA 1 DbldA 1 M600 1 M600 1 M600 1 M600 1 M600 2 M600 2 M600 2 M600 2 DbldA 2 DbldA 2 DbldA 2 DbldA 2 D D4263 M600 E S E S 4251 4252 4253 SCO 0762 SCO 4253 SCO4252, 4253 and 4262 SCO4246 and 4256 A DbldA M600 DbldA M600 B SCO4251 SCO4252, basic SCO4252, acidic SCO4253 C E ggaacatgcccccgctccggcacccggggacgtttcggca tcggcaacgcgcgcgtgaggctgaggggcgtcctgtctcg taccccgaggagagcagagcatgccgtcctacctgtcgcccggcgtctacgtcgaggaggtggccagcggctcgcgcccg atcgagggagtgggcacgtc

More Related