'Molecular biology' diaporamas de présentation

2.46k views • 112 slides

Bi430/530 Theory of Recombinant DNA Techniques

Bi430/530 Theory of Recombinant DNA Techniques. First part of course : Technical aspects of molecular biology work--Molecular Cloning Second part of course : Applications of molecular biology techniques Emerging science Bi530 student presentations Prerequisite: Molecular Biology (Bi 338)

1.46k views • 78 slides

Fundamentals in Sequence Analysis 1.(part 1)

Fundamentals in Sequence Analysis 1.(part 1). Review of Basic biology + database searching in Biology. Hugues Sicotte NCBI. The Flow of Biotechnology Information. Gene. Function. > DNA sequence AATTCATGAAAATCGTATACTGGTCTGGTACCGGCAACAC TGAGAAAATGGCAGAGCTCATCGCTAAAGGTATCATCGAA

1.16k views • 75 slides

Genetic Model Systems : Yeast

Genetic Model Systems : Yeast. David M. Bedwell, Ph.D. Department of Microbiology BBRB 432 Phone: 934-6593 E-mail: dbedwell@uab.edu Web: www.microbio.uab.edu/Bedwell/.

2.32k views • 50 slides

Computer Aided Molecular Design

Computer Aided Molecular Design. A Strategy for Meeting the Challenges We Face. An Organized Guide. Build Chemical Insight Discover new molecules Predict their properties. Working at the Intersection. Structural Biology Biochemistry Medicinal Chemistry Toxicology Pharmacology

1.04k views • 49 slides

Computer Aided Molecular Design

Computer Aided Molecular Design. A Strategy for Meeting the Challenges We Face. An Organized Guide. Build Chemical Insight Discover new molecules Predict their properties. Working at the Intersection. Structural Biology Biochemistry Medicinal Chemistry Toxicology Pharmacology

1.04k views • 49 slides

Basic Molecular Biology

Basic Molecular Biology. Many slides by Omkar Deshpande. Overview. Structures of biomolecules Central Dogma of Molecular Biology Overview of this course Computer scientists vs Biologists.

650 views • 40 slides

Biology Overview

Biology Overview. Microarray Database Systems 9/18/2002. Additional Information. Review papers on microarray Genomics, gene expression and DNA arrays (Nature, June 2000) Microarray - technology review (Natural Cell Biology, Aug. 2001) Magic of Microarrays (Scientific American, Feb. 2002)

885 views • 39 slides

By Kristie Akl

The Race to Discover DNA. By Kristie Akl. Scientists call this the:. DNA. DNA. Central Dogma of Molecular Biology!. RNA. RNA. Protein. Protein. How do we know that all of our genetic information comes from DNA?.

717 views • 33 slides

OPTOMETRY SCHOOLS

954 views • 31 slides

Synthetic Biology

Synthetic Biology. 6. Synthetic Biology. What is Synthetic Biology?. Discover Magazine: Scientists of the Year. Undergraduates in Synthetic Bio. international Genetically Engineered Machines. http://parts.mit.edu/registry/index.php/Main_Page. 37 Teams in 2006; 57 in 2007.

890 views • 28 slides

Animal Models for Predicting Sensitization Potential

Animal Models for Predicting Sensitization Potential . Judith C. Stadler Haskell Laboratory, DuPont Company Newark, DE. Dermal Sensitization. Regulatory Acceptance Guinea Pig Buehler Maximization Test Mouse Local Lymph Node Assay. Dermal Sensitization (continued). Other Tests

806 views • 24 slides

3D Molecular Structures

3D Molecular Structures. C371 Fall 2004. Morgan Algorithm (Leach & Gillet, p. 8). Bioisosteres (Leach & Gillet, p. 31). Milestones In Chemical Information: IV (PW).

676 views • 24 slides

2D-SDS Gel Electrophoresis

2D-SDS Gel Electrophoresis. July 1, 2003 Theoretical basis for 2D-SDS Gel Elect The SWISS-2DPAGE Database Workshop. 2D-SDS Gel Electrophoresis What is it?.

937 views • 24 slides

Assessing Graduate Student Research Behaviors: Humanities, Social Sciences, and Sciences

Assessing Graduate Student Research Behaviors: Humanities, Social Sciences, and Sciences. ARL Fall Forum Cecily Marcus & Karen Williams October 12, 2007. A Multi-Dimensional Framework for Academic Support: Humanities and Social Sciences 2005-2006 Funded by the Andrew W. Mellon Foundation.

476 views • 17 slides

Computational Biology

Computational Biology. Dr. Isabel Darcy EC 3.914 972-882-4435 darcy@utdallas.edu www.utdallas.edu/~darcy. Human Genome:. 3 billion base pairs 46 chromosomes ~5% of genome codes for protein. 95% junk DNA??? Thryroglobin gene: (extreme example) introns: more 100,000 bp

562 views • 17 slides

GRADUATE SCHOOL ADMISSIONS TESTING

466 views • 16 slides

707 views • 12 slides

Welcome to Biochemistry

Welcome to Biochemistry. Biochemistry Practical Laboratories Practical teaching on the Molecular Biology modules takes place in the teaching lab in Biochemistry. Practical Experience. Views from the Biochemistry Top Floor Coffee Room.

321 views • 4 slides

SYNTHESIS OF P EPTIDE N UCLEIC A CID (PNA) OLIGOMERS AND THEIR CONJUGATES

630 views • 1 slides