200 likes | 394 Vues
Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks. Lee H. Harrison, MD Associate Professor Departments of Epidemiology and Medicine University of Pittsburgh. What is molecular epidemiology in infectious diseases?.
E N D
Routine Molecular Epidemiology for Enhanced Detection and Control of Foodborne Outbreaks Lee H. Harrison, MD Associate Professor Departments of Epidemiology and Medicine University of Pittsburgh
What is molecular epidemiology in infectious diseases? • Purpose: Determine modes of transmission and source of infection • Principal: Exploit pheno-/genotypic differences between strains • Practice: Molecular subtyping of bacterial/fungal/viral/parasitic isolates
Molecular Epidemiology in Infectious Diseases: Why molecular methods? • Previously used methods: • antimicrobial susceptibility patterns • serologic/biochemical typing • Examples: • 95% of invasive H. influenzae were serotype b • L. monocytogenes: 3 major serotypes (1/2a, 1/2b, 4b)
Molecular Epidemiology in Infectious Diseases: Basic Types of Methods • Genotypic methods • DNA based • Heritable and stable • Not affected by isolation/culture conditions • Phenotypic methods • Rely on expressed characteristics • Affected by isolation/culture/test conditions
Molecular Epidemiology in Infectious Diseases: Common Methods • Analysis of chromosomal DNA • Restriction endonuclease analysis (REA) • Pulse field gel electrophoresis (PFGE) • Restriction fragment length polymorphism (RFLP) • rDNA gene restriction patterns (ribotyping) • Nucleic acid sequencing • Nucleic acid hybridization of entire genome
Molecular Epidemiology in Infectious Diseases: Common Methods • Analysis of plasmid DNA • Plasmid size • Restriction digests • Protein analysis • Outer membrane protein (OMP) analysis • Multilocus enzyme typing (MLE)
Endonuclease EcoR I Hind III Hha II Sequence GAATTC CTTAAG AAGCTT TTCGAA CCGG GGCC Recognition Sequences ofSelected Restriction Endonucleases Source Escherichia coli RY13 H. influenzae Rd H. parainfluenze
DNA Cutting by HIND III: StaggeredCuts Leaving “Sticky” Ends TTCGAATAAGCTTCCCTGAG AAGCTTATTCGAAGGGACTC TTCGAATA AAGCTTATTCG AGCTTCCCTGAG AAGGGACTC +
General principals of molecular subtyping using restriction endonucleases Bacterial chromosomal DNA . C . C . C . C Electrophoresis . C . . C . . C C C . C = Restriction endonuclease (“molecular scissors”) = DNA sequence recognized by restriction endonuclease
Molecular Epidemiology in Infectious Diseases: Common Methods • Nucleic acid detection • Plasmid size • Restriction digests • Phage typing
Molecular Epidemiology in Infectious Diseases: Interpretation of Data • Heterogeneity within species • Must have knowledge of frequency distribution of subtypes • Utility of individual method is species specific
Molecular Epidemiology in Infectious Diseases: Requirements • Method must work with vast majority of isolates • Reproducibility • Discrimination power • Ease of method • Ease of interpretation