1 / 21

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone. http://www.mapwatch.com/news-blog/images/phytoplankton.jpg. By Pete Kahn Mentors: Lydie Herfort and Peter Zuber. Significance of phytoplankton. Major primary producers: O 2 : 90%

dexter-neal
Télécharger la présentation

18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 18S rRNA clone library of phytoplankton in the Columbia River and its coastal zone http://www.mapwatch.com/news-blog/images/phytoplankton.jpg By Pete Kahn Mentors: Lydie Herfort and Peter Zuber

  2. Significance of phytoplankton • Major primary producers: O2: 90% CO2=>C3: 50% • Most abundant eukaryotes: 102 to 104 cells/ mL • Base of aquatic food chain

  3. Interactions with other Domains http://www.fossilmuseum.net/Tree_of_Life/Domains_Archaea_Bacteria/Domains_of_life.jpg BacterioplanktonColonization : POC=>DOC “Competition” for NO32- and NH3? • Grossart, H. P., Czub, G. & Simon,M. (2006). Algae-bacteria interactions and their effects on aggregation and organic matter flux in the sea. Environmental Microbiology8, 1074-1084.

  4. Traditional Methods Flow cytometry Microscopy: Pediastrium • Microscopy • Flow Cytometry • Pigment analysis: Chl a • Photosynthesis: O2 production C14 uptake http://upload.wikimedia.org/wikipedia/commons/c/c7/Picoplancton_cytometrie.jpg http://www.keweenawalgae.mtu.edu/ALGAL_IMAGES/chlorophyceans/Pediastrium_n16_dollartow3_402_c.jpg Filtering for chlorophyll a

  5. Molecular Methods for eukaryotes • Pitfalls of Traditional methods: -Microscopy: focus on numerous, “big” organisms; time consuming -Incomplete understanding of diversity • Molecular Methods: nucleic acid extraction, PCR, cloning, sequencing • Pitfalls of Molecular Methods: biases in PCR primers & preferential amplification of some organisms, i.e. dinoflagellates vs diatoms Savin, M. C., Martin, J. L., LeGresley, M., Giewat, M. & Rooney-Varga, J. (2004). Plankton diversity in the Bay of Fundy as measured by morphological andmolecular methods. Microbial Ecology 48, 51-65.

  6. Problems for phytoplankton • Traditional methods studies >>>> molecular methods studies • Prokaryotic molecular studies >>>> phytoplankton molecular studies

  7. The sampling plan • 18S rRNA clone library for: April: Wecoma & Forerunner: salinity gradient Wecoma (CR4s, CR15s, CR30s, CR40s): 20-32 psu; coastal surface samples Forerunner (St 1-5): estuary samples 0-20 psu, inc. of 5 June & July: Forerunner: 0 psu & 30 psu from estuary

  8. Sample Dates & Locations Wecoma April 2007 Forerunner April 2007 Forerunner June 2007 Forerunner July 2007

  9. Goals within CMOP • Short term: -Good clone library of phytoplankton -Determining good primers for isolating 18S rRNA • Long term: -Understand changes in populations between seasons and locations -Better understand unexpected changes in community: monitor ecosystem health -Bacteria & Archaea relationships/ interactions (Dan Murphy) -Better understanding of microbial ecosystem as a whole

  10. What we know about Columbia River phytoplankton • Anderson GC. 1972. Aspects of marine phytoplankon studies near the Columbia River with special reference to subsurface chlorophyll maximum. The Columbia River estuary and adjacent ocean waters, University of Washington Press, Seattle, WA, p. 219-240. • Contaminant ecology of fish and wildlife of the lower columbia river-final report. April 1996. Lower Columbia River Bi-State Program. • Frey BE, R Lara-Lara, LF Small. 1984. Primary production in the Columbia River Estuary water column. Columbia River Estuary Data Development Program.

  11. What we know about Columbia River phytoplankton Asterionella formosa: most abundant diatom • Estuary: >50 species of diatoms; Asterionella formosa; Asterionella kariana; Skeletonema Costatum; Thallasiosira; Stephanodiscus hatzschii • Coastal: Chaetoceros convolutus; Dactyliosolen mediterraneus; Thalassionema nitzschioides http://www.serc.si.edu/labs/phytoplankton/guide/diatoms/images/Asterionella/Asterionella-formosa-PA.jpg Thalassionema nitzschioides http://thalassa.gso.uri.edu/flora/imagesfl/tnema1.jpg

  12. Variations in nucleic acid in environmental samples Oct 2006 Feb 2007 • Between seasons • Between locations April Wecoma & Forerunner: Freshwater << Surface Coastal DNA RNA

  13. Methods Overview Water sample => Sterivex on site Total nucleic acid extraction from sterivex in lab DNA removal? Amplification through PCR TOPO cloning/ transformation 96 well plates? Plasmid isolation (Miniprep) Water samples pass through sterivex filter Sequences BLAST=> Clone library

  14. Extraction/ DNA removal • Extraction with LETS buffer + Phenol Chloroform • DNA removal with TURBO DNA free kit or Ribopure kit DNA removed DNA not removed Gel after extraction & DNA removal Sterivex

  15. PCR • Primers: Euk A: AACCTGGTTGATCCTGCC Euk B: TGATCCTTCTGCAGGTTCACCTAC Specific for eukaryotes, Examined with BLAST: highly conserved • PCR cleanup with MO-BIO ultra clean kit Gel after PCR Diez, B., Pedros-Alio, C. & Massana, R. (2001). Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Applied and Environmental Microbiology67, 2932-2941.

  16. Cloning/ Transformation • TOPO TA Cloning Kit • Transformation with Top 10 chemical competent cells => E. coli • Plated onto LB XGAL-AMP plates -Selective: cells gain ampicillin resistance from plasmid -Differential: cells w/plasmid insert turn white cells w/ no insert turn blue

  17. Plasmid isolation (miniprep) • For 96 well plate, no miniprep. Send to Washington University • Recover plasmid from E. coli host • Clean plasmid and prepare to concentration of 100 ng/ ul • Take to primate center for sequencing Gel from miniprep

  18. St 1 (0 psu): Rhizophydium St 4 (15 psu): Pseudopedinella elastica; Protperidinium leonis; Katablepharis japonica CR4s (27 psu): Asterionella kariana*; Thalassiosira aestivalis* Pirsonia guinardiae Gyrodinium rubrum CR 15s (20 psu): Thalassiosira pseudonana*: Sequences from April Diatom: 1st to have genome sequenced Dinoflagellate Fungus http://genome.jgi-psf.org/Thaps3/Thaps3.home.html http://www.bsu.edu/classes/ruch/msa/barr/4-1.jpg http://www4.fimr.fi/project/algaline/GALLERY/0709NBP.JPG

  19. Sequences from Station 1 (0 psu) June • Skeletonema costatum* -Diatom; extremely abundant in temperate areas • Aulacoseira ambigua -river diatom • Stephanodiscus hantzschii* -eutrophic freshwater diatom • Cyclotella meneghiniana -river diatom; areas of high conductivity http://thalassa.gso.uri.edu/ESphyto/list/taxa/skel/skelcos.htm http://craticula.ncl.ac.uk/Eddi/jsp/taxon.jsp?TaxonId=AU002A http://www.lancs.ac.uk/staff/kingl/telford/stephhant.htm http://craticula.ncl.ac.uk/EADiatomKey/html/taxon11.html

  20. Next step • Use multiple primer sets to decrease PCR biases • Traditional methods: Chl a analysis; Flow cytometry; Primary productivity rates • Apply protocol to ETM on future cruises

  21. Acknowledgements • Lydie and Peter • Michiko Nakano • Dan Murphy • Everyone in Peter & Michiko’s labs • Michael Wilkin & the crew of the Forerunner • Antonio Baptista • NSF • All of you

More Related