DNA Fingerprinting
PBG/MCB 620 DNA Fingerprinting. DNA Fingerprinting . A method for the detection of DNA variation. image source - http://db2.photoresearchers.com/feature/infocus1. Applications of DNA fingerprinting. Human genetics and disease Systematics and taxonomy
DNA Fingerprinting
E N D
Presentation Transcript
PBG/MCB 620 DNA Fingerprinting DNA Fingerprinting A method for the detection of DNA variation image source - http://db2.photoresearchers.com/feature/infocus1
Applications of DNA fingerprinting • Human genetics and disease • Systematics and taxonomy • Population, quantitative, and evolutionary genetics • Plant and animal breeding and genetics • Legal, forensic, and anthropological analysis • Genome mapping and analysis
Important Timeline Discovery of DNA as the Hereditary Material in 1944 DNA structure described in 1953 Restriction endonucleases discovered in 1968-1969 DNA sequencing described in 1977 DNA fingerprinting first used in 1985 Polymerase chain reaction (PCR) invented in 1985
DeoxyriboNucleic Acid (DNA) structure “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material” (Watson and Crick 1953)
DNA STRUCTURE • DNA is the hereditary material and contains all the information needed to build an organism. • It is a polymeric molecule made from discrete units called nucleotides. • Nucleotides link together to form a DNA strand at positions 3’ and 5’ • Nitrogenous base: • Purines: Adenine and Guanine • Pyrimidines: Thymine and Cytosine Sugar: 2-deoxyribose Phosphate group Nucleotide Thymidine
2 strands of polynucleotides: • Twisted around each other in clock-wise direction • Antiparallel: complementary and inverse • H-Bridges links that are specific: G C A T
The structure of DNA is identical in all eukaryotes, therefore the genetic information resides in the sequence of their bases Gene is a DNA segment with a sequence of bases that has the information for a biologic function. Alternative forms of a gene are called alleles
WHERE IS THE DNA LOCATED IN EUKARYOTES? • A small fraction is located in the organelles: • Chloroplats (cpDNA): 135 to 160 kb with high density of genes • Mithocondria (mtDNA): 370 to 490 kb. Only about 10% are genes • Most of it in the nucleus: • 63 Mb to 150 Gb in plants; 20Mb to 130 Gb in animals • Number of molecules (chromosomes) highly variable: 2 to >500 in animals and 2 to >1000 in plants. • Just a very small fraction of the genome is actual genes. • Some tens of thousand genes and gene clusters are scatterd around in a vast majority of apparently non-functional DNA. • DNA is associated with other components (mainly proteins) and form a complex called Chromatin. Nucleus Mitochondria Chloroplast From Brooker et al. Genetics: Analysis & Principles. McGraw Hill. 2009
WHERE IS THE DNA LOCATED IN EUKARYOTES? • Chromatin: • The basic structure of chromatin is made of DNA and proteins (histones) • The structure of the chromatin changes throughout the cell cycle: • Most of the time, when the cell is not undergoing mitosis, the chromatin is relatively uncondensed. However, there are more compacted zones (heterochromatin) and less compacted zones (euchromatin, which is the majority). • When the cell is going to divide, the chromatin gets more and more compacted producing individualized structures called methaphasic chromosomes From Brooker et al. Genetics: Analysis & Principles. McGraw Hill. 2009
DNA MUTATIONS Changes in the nucleotide sequence of genomic DNA that can be transmitted to the descendants. If these changes occur in the sequence of a gene, it is called a mutant allele. The most frequent allele is called the wild type. A DNA sequence is polymorphic if there is variation among the individuals of the population.
DNA MUTATIONS Types of mutations depending on the effect on the DNA sequence: 5’ – AgctgAactcgacctcgcgatccgtagttAgactag -3’ Wildtype 5’ – AgctgAactcggcctcgcgatccgtagttAgactag -3’ Substitution (transition: A G 5’ – AgctCAactcgacctcgcgatccgtagttAGactag -3’ Substitution (transversion: G C) C 5’ – AgctAactcgacctcgcgatccgtagttAGactag -3’ Deletion (single bp) CAactcgacc 5’ – AgcttcgcgatccgtagttAGactag -3’ Deletion (DNA segment)
DNA MUTATIONS Types of mutations depending on the effect on the DNA sequence: 5’ – AgctgAactcgacctcgcgatccgtagttAgactag - 3’ Wildtype 5’ – AgctGAactAcgacctcgcgatccgtagttAGactag - 3’ Insertion (single bp) 5’ – AgctGAactAGTCTGCCcgacctcgcgatccgtagttAGactag-3’ Insertion (DNA segment) 5’ – AgcAGTTGAcgacctcgcgatccgtagttAGactag-3’ Inversion Tranposition: 5’ – AgctcgacctcgcgatccgtagttAtgAacgactag- 3’
DNA MUTATIONS Types of mutations depending on the effect on the protein: 5’ – AgctCAactcgacctcgcgatccgAagttAgactag- 3’ Wildtype Arg Ser Ser Leu Asp Lys Asp Thr Arg Pro STOP Pro 5’ – AgctCAactcgacctcgTgatccgAagttAgactag- 3’ Silent Arg Ser Ser Leu Asp Lys Asp Thr Arg Pro STOP Pro 5’ – AgctCAactcgacctTgcgatccgAagttAgactag- 3’ Amino acid change Cys Ser Ser Leu Asp Lys Asp Thr Arg Pro STOP Pro A 5’ – AgctCAactcgcctcgcgatccgAagttAgactag- 3’ Frame shift Ala Ser Ser STOP Ser Ile Thr Arg Leu Arg 5’ – AgctCAactcgacctcgcgatccgTagttAgactag- 3’ STOP Arg Ser Ser Lys Asp Thr Arg Pro Pro
REPLICATION TRANSLATION TRANSCRIPTION RNA DNA PROTEINS
DNA REPLICATION • DNA primase: catalyzes the synthesis of a short RNA primer complementary to a single strand DNA template • Helicase: unwinds and separates the two strands of DNA • Gyrase: facilitates the action of the helicase relieving tension of the coiled DNA • Single Stranded DNA binding proteins (SSB): stabilize single strand DNA • DNA polymerase: synthesize a new DNA strand complementary to a template strand by adding nucleotides one at a time to a 3’ end.
POLYMERASE CHAIN REACTION – PCR • Invented by K.B Mullis in 1983 • Allows in vitro amplification of ANY DNA sequence in large numbers • Design of two single stranded oligonucleotide primers complementary to motifs on the template DNA.
A Polymerase extends the 3’ end of the primer sequence using the DNA strand as a template.
POLYMERASE CHAIN REACTION – PCR • Each cycle can be repeated multiple times if the 3’ end of the primer is facing the target amplicon. The reaction is typically repeated 25-50 cycles. • Each cycle generates exponential numbers of DNA fragments that are identical copies of the original DNA strand between the two binding sites. • The PCR reaction consists of: • A buffer • DNA polymerase (thermostable) • Deoxyrybonucleotidetriphospates(dNTPs) • Two primers (oligonucleotides) • Template DNA • And has the following steps: • Denaturing: raising the temperature to 94 C to make DNA single stranded • Annealing: lowering the temperature to 35 – 65 C the primers bind to the target sequences on the template DNA • Elongation: DNA polymerase extends the 3’ ends of the primer sequence. Temperature must be optimal for DNA polymerase activity.
1st cycle 2nd cycle
http://www.dnalc.org/resources/animations/pcr.html • http://learn.genetics.utah.edu/content/labs/pcr/ POLYMERASE CHAIN REACTION – Links: 3rd cycle
Restriction Endonucleases • Enzymes which recognize a specific sequence of bases within double-stranded DNA. • Endonucleases make a double-stranded cut at the recognition site. • Examples: EcoRI 5‘- G|AATTC 3‘- CTTAA|G BamHI 5‘- G|GATCC 3‘- CCTAG|G HindIII 5‘- A|AGCTT 3‘- TTCGA|A
A process used to separate DNA fragments • An electric current passes through agarose or polyacrylamide gels • The electrical current forces molecules to migrate into the gel at different rates depending on their sizes From Hartwell et al. Genetics. McGraw Hill. 2008
Link: http://www.wellcome.ac.uk/Education-resources/Teaching-and-education/Animations/DNA/WTDV026689.htm SANGER DNA SEQUENCING • Buffer • DNA polymerase • dNTPs • Labeled primer • Target DNA ddATP ddGTP deoxinucleotyde (dNTP) dideoxinucleotyde (ddNTP) ddTTP ddCTP
G C A T *TTAAGTACATACCTAGTACCACTATATAATG *GCTTAAGTACATACCTAGTACCACTATATAATG *TAAGTACATACCTAGTACCACTATATAATG *GTACATACCTAGTACCACTATATAATG *TACATACCTAGTACCACTATATAATG *GTACCACTATATAATG *TACCTAGTACCACTATATAATG *TAGTACCACTATATAATG *ACGCTTAAGTACATACCTAGTACCACTATATAATG *CGCTTAAGTACATACCTAGTACCACTATATAATG *AAGTACATACCTAGTACCACTATATAATG *CATACCTAGTACCACTATATAATG *AGTACATACCTAGTACCACTATATAATG *CCTAGTACCACTATATAATG Separate gel lanes Single gel lane *ATACCTAGTACCACTATATAATG *CTAGTACCACTATATAATG *ACCTAGTACCACTATATAATG *AGTACCACTATATAATG
DNA polymorphisms • Insertion-deletion length polymorphism – INDEL • Single nucleotide polymorphism – SNP • Simple sequence repeat length polymorphism – mini- and micro-satellites
Allele A Allele a a a A a A a a A Ind 5 Ind 1 Ind 3 Ind 4 Ind 2 Ind 8 Ind 6 Ind 7
Allele A Allele a a a A a A a a A Ind 5 Ind 1 Ind 3 Ind 4 Ind 2 Ind 8 Ind 6 Ind 7
Restriction Fragment Length Polymorphism (RFLP) • RFLPs (Botstein et al. 1980) are differences in restriction fragment lengths caused by a SNP or INDEL that create or abolish restriction endonuclease recognition sites. • RFLP assays are based on hybridization of a labeled DNA probe to a Southern blot (Southern 1975) of DNA digested with a restriction endonuclease Labeled 3’ TGGCTAGCT 5’ Probe 3’ TGGCTAGCT 5’ ||||||||| Target 1 5’-CCTAACCGATCGACTGAC-3’ 2 5’-GGATTGGCTAGCTGACTG-3’
Features of RFLPs • Co-dominant • Locus-specific • Genes can be mapped directly • Supply of probes and markers is unlimited • Highly reproducible • Requires no special instrumentation