1.06k likes | 1.4k Vues
DNA Transcription and Translation. Sections 12.3 and 12.4. Do Now. 1. What is RNA? 2. What are proteins used for in our bodies? 3. Fill in the chart below:. Gene. Segment of DNA that codes for a protein The Central Dogma of Biology:
E N D
DNA Transcription and Translation Sections 12.3 and 12.4
Do Now • 1. What is RNA? • 2. What are proteins used for in our bodies? • 3. Fill in the chart below:
Gene • Segment of DNA that codes for a protein • The Central Dogma of Biology: • DNA codes for RNA and RNA makes protein (the synthesis of)
One Gene – One Enzyme • The Beadle and Tatum experiment showed that one gene codes for one enzyme. • One gene codes for one polypeptide. • polypeptide - a chain of covalently bonded amino acids. • (proteins are made of one or more polypeptide)
RNA • RNA stands for: • Ribonucleic acid • RNA is found: • Nucleus and Cytoplasm
RNA Structure • Like DNA, RNA is made up of subunits called _____________, which are made of three parts: • Sugar (ribose) • Phosphate • Nitrogen Base
RNA’s Nitrogen Bases • Adenine (A) • Cytosine (C) • Guanine (G) • Uracil (U)
There are 3 types of RNA: • Messenger RNA (mRNA) – long strands of RNA nucleotides that are formed complementary to one strand of DNA. • Transfer RNA (tRNA) – smaller segments of RNA nucleotides that transport amino acids to the ribosomes. • Ribosomal RNA (rRNA) – associates with protein to form the ribosome.
All RNA is … • Single stranded • Many different shapes • “Cheap copy” of DNA
Do Now • 1. What is a protein made of? • 2. Explain the process between DNA and proteins.
Transcription • First step in making proteins • Process of taking one gene (DNA) and converting into a mRNA strand • DNA -> RNA • Location: • Nucleus of the cell
Steps to Transcription • 1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA
Steps to Transcription (Cont.) • 2. One strand acts as a template.
Steps to Transcription (Cont.) • 3. A mRNA copy is made from the DNA template strand by RNA polymerase • 4. A mRNA copy is made until it reaches the termination (stop signal) sequence • 5. The two strands of DNA rejoin.
Transcription animation • https://www.youtube.com/watch?v=ztPkv7wc3yU
mRNA Processing • Pre-mRNA – the original sequence of RNA created during transcription • mRNA reaches the ribosomes
What is RNA Processing? • After transcription the pre-mRNA molecule undergoes processing • 5’ cap is added • Poly A tail is added to the 3’ end • Introns are removed.
Do Now • Label the Transcription diagram
RNA Processing • In Eukaryotes only • Introns- non-coded sections • Exons- codes for a protein • Before RNA leaves the nucleus, introns are removed and exons are spliced together • A cap and poly A tail are added to ends of the sequence • mRNA leaves the nucleus through the nuclear pores
Let’s try an activity (11.5) • http://www2.pearsonsuccessnet.com/snpapp/iText/products/0-13-115075-8/index.html
Pg. 339 • Pg. 339
3’ CAUGAUGUACGAUACGUA 5’ cap Let’s an example… • Original DNA Sequence (DNA): • 5’ GTACTACATGCTATGCAT 3’ • Translate it (RNA): • 3’ CAUGAUGUACGAUACGUA 5’ • Add the 5’ cap:
Add a poly A tail onto the 3’ end Poly A tail 3’ CAUGAUGUACGAUACGUA 5’ 3’ CAUGACGGUA 5’ 3’ CAUGACGGUA 5’ cap cap cap Finish the job! • Remove the introns “UGUA” and “AUAC”:
Get a new partner! • DNA Strand of non-template strand: • 5’ ATCGGTAGAGTATTTACAGATA 3’ • Remove introns: • CGGUA UUACAG
Think, Pair, Share • Take a minute think on your own, then pair with your partner, and share your ideas! • Evolutionary, why do you think there are introns? • Where did they come from? • Why do we have them? • Remember there is NO wrong answer!
Proteins are made up of amino acids!!! • Proteins are polymers of amino acids • Only 20 different amino acids • BUT there are hundreds of thousands of different proteins How can this be?
Let’s compare to it to the English language • How many letters are in the alphabet? A,b,c,d,… 26 • How many words are there? Miss, Ings, is, smart, .. Almost infinite! • Each word has a unique structure of letters. • Similar to proteins and amino acids
Proteins- (PCFNa) -made of 20 different Amino Acids - Amino Acids bond to form polypeptide chains
How do amino acids form these peptide chains? Peptide Bonds – Link each amino acids together to form proteins
How many amino acids are in a dipeptide chain? How about a tripeptide chain? How many water molecules are formed from 2 amino acids? How many water molecules are formed from 100 amino acids?
Do Now • Perform transcription on this DNA segment: GCTTCATACGA • Do RNA processing and remove the introns: GAA and UGC • How does this mRNA sequence leave the nucleus? • Where does it go?
Protein Structure http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/structure/HbMb/hbmb.htm
Translation • Production of proteins from mRNA • mRNA goes to the ribosomes in the cytoplasm or the RER and produces proteins
Steps to Translation • 1. mRNA leaves the nucleus and binds to a ribosome • 2. the 5’ end of mRNA binds to ribosome
Ribosome • Two subunits to the ribosome • 3 grooves on the ribosome (A, P, E) • A: tRNA binding site • P: polypeptite bonding site • E: exit site