Understanding Bacterial Transformation and RNA Protein Synthesis
This chapter explores the processes of bacterial transformation and RNA protein synthesis. It begins with Griffith's 1928 experiments that revealed how one strain of bacteria can alter another through DNA exchange, with consequences in disease, particularly in pneumonia. We then delve into the intricacies of RNA synthesis, detailing how DNA instructions are transcribed into mRNA, which subsequently travels to ribosomes for translation into proteins. These proteins ultimately determine traits such as blood type and flower color, illustrating the central role of genetic coding in biology.
Understanding Bacterial Transformation and RNA Protein Synthesis
E N D
Presentation Transcript
Chapter 11 AcademicChapter 9 Honors Text book Notes
12-1 • TRANSFORMATION- process by which 1 strain of bacteria is altered due to the DNA of another bacteria… (p 288) • How did we find out that this happens…?
1928 Griffith: British scientist • Prob? How do bacteria make people sick? • Specifically the bacteria pneumonia… • Materials: mice, syringe, diseased bacteria(A), healthy bacteria(B) • Results : (what do you think will happen- which bcateria will kill the mice?)
12-3 RNA & Protein Synthesis • Synthesis? • DNA instruction is in code • ATCCGGTTAAAGGTCCCTCTCTGATCCCGTATTAAAGTCGATTGACGATGCAGTGACGATGAAGTCGAAAACCGGTTGTGTGCCAGTGGCAGTGATG • Code controls the making of proteins (which control traits: ex blood type, flower color ) • QUESTION OF THE DAY: • How can we decode that message?
Decode Message • Message needs to go from nucleus to ribosomes….
Meet the RNA family … • mRNA travels to ribosomes • rRNA is present at the ribosomes • tRNA- transfers the amino acids to the ribosomes
Transcription • Step 1: mRNA goes over to the DNA in the nucleus, and finds the original strand • Step 2: mRNA looks only for the section that it needs to copy • Step 3: mRNA finds the section and copies it but in its own complementary language • Step 4: mRNA goes to Ribosome with message
Translation • Step 1: mRNA arrives at the ribosome, and rRNA is already there waiting…. • Step 2: mRNA and rRNA show the section of the code in codons in (mRNA language) to all the present tRNA’s • Step 3: the tRNA’s look at their anticodons, and see which codons they match. They will match their corresponding codons with the right amino acid. • Step 4: After a bunch of amino acids line up- proteins are made….
http://www.youtube.com/watch?v=983lhh20rGY • Video transcription and translation • Video replication • http://www.youtube.com/watch?v=hfZ8o9D1tus&feature=related