1 / 44

Hybridization of Nucleic Acids

Hybridization of Nucleic Acids. DNA1. DNA2. RNA. Probe. Northern hybridization. Southern hybridization. Juang RH (2004) BCbasics. Preparation of Traditional Nucleic Acid Probe. Amino acid sequence. GLY-ASP-GLU-SER-SER-VAL-LEU-----. GGG-GAC-GAG-TCC-TCC-GTT-CTC---.

elisa
Télécharger la présentation

Hybridization of Nucleic Acids

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Hybridization of Nucleic Acids DNA1 DNA2 RNA Probe Northern hybridization Southern hybridization Juang RH (2004) BCbasics

  2. Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-SER-VAL-LEU----- GGG-GAC-GAG-TCC-TCC-GTT-CTC--- Nucleic acid sequence * ** * * * * * Codon degeneracy The nucleic acid sequence is Deduced from amino acid sequence Synthesizing oligonucleotide Chemical synthesis PROBE:GGGGACGAGTCCTCCGTTCT Juang RH (2004) BCbasics

  3. Probe is labeled with radioactive 32P Hybridization DNA denaturation Target gene Single colony Lysed Juang RH (2004) BCbasics

  4. Colony Is Screened by Hybridization with Probe Colony hybridization Cover with filter paper Transferring … Collect filter paper Autoradiography Dissolve cell DNA denatured Add probe Juang RH (2004) BCbasics

  5. Biochip Based on Hybridization Sample DNA Complementary DNA hybridize Biochip Each spot contains known DNA Signal appears Schena (2000) Microarray Biochip Technology, p. A31 Juang RH (2004) BCbasics

  6. The Genetic Code • Initiation and termination Codons • Initiation codon: AUG • Termination codons: UAA, UAG, UGA • Degeneracy: partial and complete • Ordered • Nearly Universal (exceptions: mitochondria and some protozoa)

  7. Key Points • Each of the 20 amino acids in proteins is specified by one or more nucleotide triplets in mRNA. (20 amino acids refers to what is attached to the tRNAs!) • Of the 64 possible triplets, given the four bases in mRNA, 61 specify amino acids and 3 signal chain termination. (have no tRNAs!)

  8. Key Points • The code is nonoverlapping, with each nucleotide part of a single codon, degenerate, with most amino acids specified by two to four codons, and ordered, with similar amino acids specified by related codons. • The genetic code is nearly universal; with minor exceptions, the 64 triplets have the same meaning in all organisms. (this is funny)

  9. Do all cells/animals make the same Repertoire of tRNAs?

  10. The Genetic Code

  11. The Wobble Hypothesis:Base-Pairing Involving the Third Base of the Codon is Less Stringent.

  12. Base-Pairing with Inosine at the Wobble Position

  13. In molecular biology, a wobble base pair is a non-Watson-Crick base pairing between two nucleotides in RNA molecules. The four main wobble base pairs are guanine-uracil, inosine-uracil, inosine-adenine, and inosine-cytosine (G-U, I-U, I-A and I-C). The thermodynamic stability of a wobble base pair is comparable to that of a Watson-Crick base pair. Wobble base pairs are fundamental in RNA secondary structure and are critical for the proper translation of the genetic code.

  14. Suppressor Mutations • Some mutations in tRNA genes alter the anticodons and therefore the codons recognized by the mutant tRNAs. • These mutations were initially detected as suppressor mutations that suppressed the effects of other mutations. • Example: tRNA mutations that suppress amber mutations (UAG chain-termination mutations) in the coding sequence of genes.

  15. Making a (UAG) Mutation

  16. Translation of an amber (UAG) Mutation in the Absence of a Suppressor tRNA

  17. Translation of an amber Mutation in the Presence of a Suppressor tRNA Note it is amber su3…why?????????

  18. Translation of an amber Mutation in the Presence of a Suppressor tRNA If there was a single tRNATyr gene, then could one have a amber supressor of it?

  19. Fig1

  20. New Base

  21. Are the proteins produced a pure reflection of the mRNA sequence???? tRNA environment, protein modifications post-translationally

  22. Good things to Know RNApol II TATAA CCATGG (Nco I site and Kozak Rule) ATG AGGT….splice GT……………A………polypyrimidine AG PolyA recog sequence AATAAA The Reasons why ATG is a single codon and TGG is a single codon.

  23. SELEX yields a functional binding site. A, COS7 cells were transfected in triplicate with either pEBG or increasing concentrations of BENwt (250, 500, and 1000 ng) and either p81TKluc (TK) luciferase reporter or p81TKluc-WT3X (WT3X). The luciferase values are reported as relative luciferase activity normalized to the amount of total protein. -Fold decrease in activity is measured relative to the basal transcriptional activity observed with pEBG empty expression vector alone. Western blot with anti-GST antibody shows dose-dependent expression of GST-BEN.

  24. B, COS7 cells were transfected in triplicate with either pEBG or BENwt (1000 ng of each) and with either TK, or WT3X or Mut3X (600 ng of each) and the Renilla construct (pRL-TK).

More Related