huong
Uploaded by
61 SLIDES
922 VUES
650LIKES

Nucleic Acids

DESCRIPTION

Nucleic Acids. Nucleic Acids Structures of Nucleic Acids DNA Replication RNA and Transcription. Nucleotides. Nucleic acids consist of nucleotides that have a sugar, nitrogen base, and phosphate nucleoside. Base. PO 4. Sugar. Nitrogen-Containing Bases. Sugars. Nucleosides in DNA.

1 / 61

Télécharger la présentation

Nucleic Acids

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Nucleic Acids Nucleic Acids Structures of Nucleic Acids DNA Replication RNA and Transcription

  2. Nucleotides Nucleic acids consist of nucleotides that have a sugar, nitrogen base, and phosphate nucleoside Base PO4 Sugar

  3. Nitrogen-Containing Bases

  4. Sugars

  5. Nucleosides in DNA Base Sugar Nucleoside Adenine (A) Deoxyribose Adenosine Guanine (G) Deoxyribose Guanosine Cytosine (C) Deoxyribose Cytidine Thymine (T) Deoxyribose Thymidine

  6. Nucleosides in RNA Base Sugar Nucleoside Adenine (A) ribose Adenosine Guanine (G) ribose Guanosine Cytosine (C) ribose Cytidine Uracil (U) ribose Uridine

  7. Example of a Nucleoside

  8. Nucleotides in DNA and RNA DNA dAMP Deoxyadenosine monophosphate dGMP Deoxyguanosine monophosphate dCMP Deoxycytidine monophosphate dTMP Deoxythymidine monophosphate RNA AMP adenosine monophosphate GMP guanosine monophosphate CMP cytidine monophosphate UMP uridine monophosphate

  9. Structure of Nucleic Acids • Polymers of four nucleotides • Linked by alternating sugar-phosphate bonds • RNA: ribose and A, G, C, U • DNA: deoxyribose and A,G,C,T nucleotide nucleotide nucleotide nucleotide base base base base sugar sugar P sugar P sugar P P

  10. Nucleic Acid Structure 3,5-phosphodiester bond 3 5

  11. Double Helix of DNA • DNA contains two strands of nucleotides • H bonds hold the two strands in a double-helix structure • A helix structure is like a spiral stair case • Bases are always paired as A–T and G-C • Thus the bases along one strand complement the bases along the other

  12. Complementary Base Pairs • Two H bonds for A-T • Three H bonds for G-C

  13. Double Helix of DNA

  14. Learning Check NA1 Write the complementary base sequence for the matching strand in the following DNA section: -A-G-T-C-C-A-A-T-G-C- • • • • • • • • • • • • • • • • • • • •

  15. Solution NA1 Write the complementary base sequence for the matching strand in the following DNA section: -A-G-T-C-C-A-A-T-G-C- • • • • • • • • • • • • • • • • • • • • -T-C-A-G-G-T-T-A-C-G-

  16. DNA Replication • DNA in the chromosomes replicates itself every cell division • Maintains correct genetic information • Two strands of DNA unwind • Each strand acts like a template • New bases pair with their complementary base • Two double helixes form that are copies of original DNA

  17. DNA Unwinds G- -C A- -T C- -G T- -A G-C A-T C-G T-A

  18. DNA Copied with Base Pairs Two copies of original DNA strand G-C G-C A-T A-T C-G C-G T-A G-A

  19. Nucleic Acid Chemistry Where the info is…interpreting the blueprint

  20. Central Dogma DNA ---------------- RNA-------------- protein Replication transcription translation

  21. Central Dogma • Replication • DNA making a copy of itself • Making a replica • Transcription • DNA being made into RNA • Still in nucleotide language • Translation • RNA being made into protein • Change to amino acid language

  22. Replication • Remember that DNA is self complementary • Replication is semiconservative • One strand goes to next generation • Other is new • Each strand is a template for the other • If one strand is 5’ AGCT 3’ • Other is: 3’ TCGA 5’

  23. Replica • Write the strand complementary to: 3’ ACTAGCCTAAGTCG 5’ Answer

  24. Replication is Semiconservative

  25. Replication • Roles of enzymes • Topoisomerases • Helicase • DNA polymerases • ligase • DNA binding proteins • DNA synthesis • Leading strand • Lagging strand

  26. Replication

  27. Replication • Helix opens • Helicase • Causes supercoiling upstream • Topoisomerases (gyrase) • DNA Binding Proteins • Prevent reannealing

  28. Replication

  29. Replication • Leading strand • 3’ end of template • As opens up, DNA polymerase binds • Makes new DNA 5’ - 3’ • Same direction as opening of helix • Made continuously

  30. Replication

  31. Replication • Lagging strand • 5’ end of template • Can’t be made continuously as direction is wrong • RNA primer • New DNA made 5’  3’ • Opposite direction of replication • Discontinuous • Okazaki fragments • Ligase closes gaps

  32. Transcription • DNA template made into RNA copy • Uracil instead of Thymine • One DNA strand is template • Sense strand • Other is just for replication • Antisense (not to be confused with nonsense!) • In nucleus • nucleoli

  33. Transcription • From following DNA strand, determine RNA sequence 3’ GCCTAAGCTCA 5’ Answer

  34. Transcription

  35. Transcription • DNA opens up • Enzymes? • RNA polymerase binds • Which strand? • Using DNA template, makes RNA • 5’-3’ • Raw transcript called hnRNA

  36. Transcription How does RNA polymerase know where to start? upstream promotor sequences Pribnow Box TATA box RNA polymerase starts transcription X nucleotides downstream of TATA box

  37. Introns and Exons • Introns • Intervening sequences • Not all DNA codes for protein • Regulatory info, “junk DNA” • Exons • Code for protein

  38. Processing of hnRNA into mRNA • 3 steps • Introns removed • Self splicing • 5’ methyl guanosine cap added • Poly A tail added • Moved to cytosol for translation

  39. Processing of hnRNA into mRNA

  40. Translation • RNA -- Protein • Change from nucleotide language to amino acid language • On ribosomes • Vectorial nature preserved • 5’ end of mRNA becomes amino terminus of protein • Translation depends on genetic code

  41. Genetic Code • Nucleotides read in triplet “codons” • 5’ - 3’ • Each codon translates to an amino acid • 64 possible codons • 3 positions and 4 possiblities (AGCU) makes 43 or 64 possibilities • Degeneracy or redundancy of code • Only 20 amino acids • Implications for mutations

  42. Genetic Code

  43. Genetic Code • Not everything translated • AUG is start codon • Find the start codon • Also are stop codons • To determine aa sequence • Find start codon • Read in threes • Continue to stop codon

  44. Translation • Steps: • Find start codon (AUG) • After start codon, read codons, in threes • Use genetic code to translate Translate the following: GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Answer

  45. Translation Process • Requires Ribosomes, rRNA, tRNA and, of course, mRNA • Ribosome • Made of protein and rRNA • 2 subunits • Has internal sites for 2 transfer RNA molecules

  46. Ribosome Left is cartoon diagramRight is actual picture

  47. Transfer RNA • Mostly double stranded • Folds back on itself • Several loops • Anticodon loop • Has complementary nucleotides to codons • 3’ end where aa attach

  48. Transfer RNA

  49. Translation • Initiation • Ribosomal subunits assemble on mRNA • rRNA aids in binding of mRNA • Elongation • tRNAs with appropriate anticodon loops bind to complex • have aa attached (done by other enzymes) • Amino acids transfer form tRNA 2 to tRNA 1 • Process repeats • Termination • tRNA with stop codon binds into ribosome • No aa attached to tRNA • Complex falls apart

  50. Translation

More Related