Nucleic Acids
Nucleic Acids. Nucleic Acids Structures of Nucleic Acids DNA Replication RNA and Transcription. Nucleotides. Nucleic acids consist of nucleotides that have a sugar, nitrogen base, and phosphate nucleoside. Base. PO 4. Sugar. Nitrogen-Containing Bases. Sugars. Nucleosides in DNA.
Nucleic Acids
E N D
Presentation Transcript
Nucleic Acids Nucleic Acids Structures of Nucleic Acids DNA Replication RNA and Transcription
Nucleotides Nucleic acids consist of nucleotides that have a sugar, nitrogen base, and phosphate nucleoside Base PO4 Sugar
Nucleosides in DNA Base Sugar Nucleoside Adenine (A) Deoxyribose Adenosine Guanine (G) Deoxyribose Guanosine Cytosine (C) Deoxyribose Cytidine Thymine (T) Deoxyribose Thymidine
Nucleosides in RNA Base Sugar Nucleoside Adenine (A) ribose Adenosine Guanine (G) ribose Guanosine Cytosine (C) ribose Cytidine Uracil (U) ribose Uridine
Nucleotides in DNA and RNA DNA dAMP Deoxyadenosine monophosphate dGMP Deoxyguanosine monophosphate dCMP Deoxycytidine monophosphate dTMP Deoxythymidine monophosphate RNA AMP adenosine monophosphate GMP guanosine monophosphate CMP cytidine monophosphate UMP uridine monophosphate
Structure of Nucleic Acids • Polymers of four nucleotides • Linked by alternating sugar-phosphate bonds • RNA: ribose and A, G, C, U • DNA: deoxyribose and A,G,C,T nucleotide nucleotide nucleotide nucleotide base base base base sugar sugar P sugar P sugar P P
Nucleic Acid Structure 3,5-phosphodiester bond 3 5
Double Helix of DNA • DNA contains two strands of nucleotides • H bonds hold the two strands in a double-helix structure • A helix structure is like a spiral stair case • Bases are always paired as A–T and G-C • Thus the bases along one strand complement the bases along the other
Complementary Base Pairs • Two H bonds for A-T • Three H bonds for G-C
Learning Check NA1 Write the complementary base sequence for the matching strand in the following DNA section: -A-G-T-C-C-A-A-T-G-C- • • • • • • • • • • • • • • • • • • • •
Solution NA1 Write the complementary base sequence for the matching strand in the following DNA section: -A-G-T-C-C-A-A-T-G-C- • • • • • • • • • • • • • • • • • • • • -T-C-A-G-G-T-T-A-C-G-
DNA Replication • DNA in the chromosomes replicates itself every cell division • Maintains correct genetic information • Two strands of DNA unwind • Each strand acts like a template • New bases pair with their complementary base • Two double helixes form that are copies of original DNA
DNA Unwinds G- -C A- -T C- -G T- -A G-C A-T C-G T-A
DNA Copied with Base Pairs Two copies of original DNA strand G-C G-C A-T A-T C-G C-G T-A G-A
Nucleic Acid Chemistry Where the info is…interpreting the blueprint
Central Dogma DNA ---------------- RNA-------------- protein Replication transcription translation
Central Dogma • Replication • DNA making a copy of itself • Making a replica • Transcription • DNA being made into RNA • Still in nucleotide language • Translation • RNA being made into protein • Change to amino acid language
Replication • Remember that DNA is self complementary • Replication is semiconservative • One strand goes to next generation • Other is new • Each strand is a template for the other • If one strand is 5’ AGCT 3’ • Other is: 3’ TCGA 5’
Replica • Write the strand complementary to: 3’ ACTAGCCTAAGTCG 5’ Answer
Replication • Roles of enzymes • Topoisomerases • Helicase • DNA polymerases • ligase • DNA binding proteins • DNA synthesis • Leading strand • Lagging strand
Replication • Helix opens • Helicase • Causes supercoiling upstream • Topoisomerases (gyrase) • DNA Binding Proteins • Prevent reannealing
Replication • Leading strand • 3’ end of template • As opens up, DNA polymerase binds • Makes new DNA 5’ - 3’ • Same direction as opening of helix • Made continuously
Replication • Lagging strand • 5’ end of template • Can’t be made continuously as direction is wrong • RNA primer • New DNA made 5’ 3’ • Opposite direction of replication • Discontinuous • Okazaki fragments • Ligase closes gaps
Transcription • DNA template made into RNA copy • Uracil instead of Thymine • One DNA strand is template • Sense strand • Other is just for replication • Antisense (not to be confused with nonsense!) • In nucleus • nucleoli
Transcription • From following DNA strand, determine RNA sequence 3’ GCCTAAGCTCA 5’ Answer
Transcription • DNA opens up • Enzymes? • RNA polymerase binds • Which strand? • Using DNA template, makes RNA • 5’-3’ • Raw transcript called hnRNA
Transcription How does RNA polymerase know where to start? upstream promotor sequences Pribnow Box TATA box RNA polymerase starts transcription X nucleotides downstream of TATA box
Introns and Exons • Introns • Intervening sequences • Not all DNA codes for protein • Regulatory info, “junk DNA” • Exons • Code for protein
Processing of hnRNA into mRNA • 3 steps • Introns removed • Self splicing • 5’ methyl guanosine cap added • Poly A tail added • Moved to cytosol for translation
Translation • RNA -- Protein • Change from nucleotide language to amino acid language • On ribosomes • Vectorial nature preserved • 5’ end of mRNA becomes amino terminus of protein • Translation depends on genetic code
Genetic Code • Nucleotides read in triplet “codons” • 5’ - 3’ • Each codon translates to an amino acid • 64 possible codons • 3 positions and 4 possiblities (AGCU) makes 43 or 64 possibilities • Degeneracy or redundancy of code • Only 20 amino acids • Implications for mutations
Genetic Code • Not everything translated • AUG is start codon • Find the start codon • Also are stop codons • To determine aa sequence • Find start codon • Read in threes • Continue to stop codon
Translation • Steps: • Find start codon (AUG) • After start codon, read codons, in threes • Use genetic code to translate Translate the following: GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Answer
Translation Process • Requires Ribosomes, rRNA, tRNA and, of course, mRNA • Ribosome • Made of protein and rRNA • 2 subunits • Has internal sites for 2 transfer RNA molecules
Ribosome Left is cartoon diagramRight is actual picture
Transfer RNA • Mostly double stranded • Folds back on itself • Several loops • Anticodon loop • Has complementary nucleotides to codons • 3’ end where aa attach
Translation • Initiation • Ribosomal subunits assemble on mRNA • rRNA aids in binding of mRNA • Elongation • tRNAs with appropriate anticodon loops bind to complex • have aa attached (done by other enzymes) • Amino acids transfer form tRNA 2 to tRNA 1 • Process repeats • Termination • tRNA with stop codon binds into ribosome • No aa attached to tRNA • Complex falls apart