Download
istorijat gra a dnk rnk proteina n.
Skip this Video
Loading SlideShow in 5 Seconds..
Istorijat, građa DNK , RNK, proteina PowerPoint Presentation
Download Presentation
Istorijat, građa DNK , RNK, proteina

Istorijat, građa DNK , RNK, proteina

1434 Vues Download Presentation
Télécharger la présentation

Istorijat, građa DNK , RNK, proteina

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. StrukturaifunkcijagenetičkogmaterijalaBiohemijska genetika – molekularnagenetika Istorijat, građa DNK, RNK, proteina

  2. Biohemijska genetika - grana genetike koja proučava biohemijsku strukturu naslednosti i promenjivosti u živom svetu.Molekularna genetika – grana genetike koja izučava nasledne promene na molekularnom nivou i utvrđuje mahanizme regulisanja aktivnosti gena.

  3. Istorijat razvoja biohemijske genetike • Friedrich Miescher (1868) • Izolacija nukleinskih kiselina

  4. Garrod (1908) Urođene greške metabolizma metabolizam fenilalanina (fenilketonurija) Istorijat razvoja biohemijske genetike

  5. DNK-faktor transformacije u Pneumococcus-u • Griffit (1928) • Transformacijapneumokoka • Kod Pneumococcus-a prvi put dokazano da je DNK nosilac naslednog materijala svih prokariota i eukariota. • postoje 2 tipa Pneumococcus-a - Rezistentni na antibiotike-patogeni (virulentne) -Senzitivni - osetljivi na antibiotike

  6. Beadle & Tatum (1941) Jedan gen- jedan enzim Nobel 1958 Istorijat razvoja biohemijske genetike

  7. Avery, Macleod and McCarty (1943) • DNK je nosilac nasledne informacije

  8. Avery, Macleod i McCarty –ev eksperiment • Nastavili istraživanja Griffita na Pneumococcus-u • Iz patogenog (S) soja izdvojili su DNK i stavili je u sredinu gde žive nepatogeni sojevi (R) i ubrzo su se pojavile i ćelije patogenog soja (S). • Ogled je pokazao da DNK ima aktivnu ulogu u naslednosti i da je nosilac genetičkih informacija.

  9. A. D. Hershey and Martha Chase -Pružili dokaz da je DNK nasledni materijal. Eksperiment su radili na nemarkiranoj E.coli koju su inficirali bakteriofagom

  10. Watson, Crick (1953) DNK je dvolančana zavojnica Nobel 1962

  11. Transkripcija Translacija Centralna dogma molekularne biologije • Crick & Gamow (1957) DNK RNK Protein Replikacija

  12. Arthur Kornberg (1958) izolovao DNK polimerazu-enzim koji sintetiše novi lanac DNK na osnovu postojećeg koji služi kao matrica. Umnožavanje DNK u epruveti

  13. Paul Berg (1972) Otkrio i izolovao restrikcione enzimekoji seku mol DNK na tačno određenom mestu (kao makaze) a zatim upotrebio enzim ligazu (lepak) da bi ponovo spojio isečene delove i tako napravio prvu veštačku-rekombinovanu DNK. Kary Mullis (1985) otkrio PCR- metod za indentifikaciju DNK fragmenata nastalih delovanjem restrikcoinih enzima. Otkrića koja su omogućila dalji razvoj biotehnologije

  14. Nukleinske kiseline • Nukleinske kiseline su polimeri nikleotida • Sastavljeni su od: • azotne baze • šećera pentoze • ostatka fosforne kiseline • Postoje dva tipa nukleinskih kiselina DNK RNK

  15. Funkcija DNK DNK sposobna da se: • reprodukuje u indentičnom obliku • prenosi nasledne informacije na potomstvo • menja se povremeno (mutacije)

  16. Hemijski sastav i struktura DNK N U K L E O Z I D NUKLEOTID 5’ 3’ Šećer Azotne baze Purinske - Adenin (A) Guanin (G) Pirimidinske - Timin (T) Citozin (C) 3’ 5’ Ostatak fosfatne kis. A T C G G C T A

  17. NUKLEOTID NUKLEOZID

  18. Struktura DNK Azotna baza je N-glikozidnom vezom povezana sa pentozom, pri čemu se N-1 atom pirimidinske, odnosno N-9 atom purinske baze povezuje sa hidroksilnom grupom C-1 atoma pentoznog šećera. Azotna baza i šećer čine nukleozid. Fosfatna kiselina je povezana estarskom vezom sa OH grupom na C-5 atomu pentoze, gradeći fosfatni estar nukleozida tj. nukleotid. N1 N-9

  19. DNK je dvočlani molekul (dvostruki heliks, zavojnica). Bazni parovi se naslojavaju jedan iznad drugih i međusobno su udaljeni 0.34 nm. Deset baznih parova (Bp)pravi pun okret (360 stepeni) u dvostrukom heliksu. Bp povezani su hidrogenskin vezama. Nasuprot baznim parovima koji se nalaze unutar mol DNK, prema periferiji postoji fosfodiestarska veza (izgrađena od fosfata i šećera koji se naizmenično smenjuju. Lanci DNK međusobno su anti paralelni (5’ kraj jednog lanca nalazi se naspram 3’ kraja drugog i obrnuto. Struktura DNK 3’ 5’

  20. Struktura DNK • Struktura DNK može biti: • PRIMARNA – broj i redosled nukleotida u jednom lancu • ctgaattgcatggtactgacctgagt • SEKUNDARNA – dva, duga komplementarna lanca međusobno povezana vodoničnim vezama • 3. TERCIJARNA – višestruko ispresavijana • i smeštena u mali prostor jedra ćelije SEKUNDARNA struktura DNK

  21. Struktura DNK

  22. Chargaff-ova pravila (1950) • Hemijska ispitivanja koje je vršio Chargaff su pokazala da DNK pokazuje dovoljnu hemijsku složenost koja je neophodna genetičkom materijalu. • Chargaff-ova pravila su potvrdila da genetička specifičnost svake biološke vrste počiva na broju i redosledu nukleotida u primarnoj strukturi DNK. • Chargaff-ova pravila glase: Broj adeninskih nukleotida jednak je broju timinskih nukleotida (A=T), a broj guaninskih nukleotida jednak je broju citozinskih nukleotida (G=C) Zastupljenost guaninskih i citozinskih nukleotida odnosno adeninskih i timinskih nukleotida karakteristična je za svaku biološku vrstu.

  23. Chargaffova pravila A = T G = C A + G = T + C A + T G + C %(G+C)  const.

  24. Otkriće sekundarne strukture DNK

  25. DIFRAKCIJA X-ZRAKA Fotografija dobijena difrakcijom X-zraka na molekulima DNK

  26. Watson-Crick-ov model strukture DNK • Model se zasnivao na 4 dokaza: • Da se DNK sastoji iz nukleotida (povezanih fosfodiestarskim vezama) • Da sastavi baza slede Chargaff-ova pravila • Pažljivo zagrevanje nativne DNK može izazvati vidljivu promenu njenim fizičkim osobinama u cilju dobijanja tkz. DENATURISANE DNK ali bez kidanja kovalentnih veza. • Difrakcija vlakana DNK pomoću X - zračenja potvrđuje spiralnu odnosno helikalnu strukturu njenog molekula

  27. Watson-Crick-ov model strukture DNK “Naš model dezoksiriboukleinske kiseline zapravo je par kalupa komplementarnih jedan drugome. Zamišljamo da se pre udvostručavanja vodonične veze prekinu, a dva lanca odmotaju i odvoje. Tada svaki lanac služi kao kalup-matrica na kom se stvara novi lanac, tako da na kraju nastanu dva para lanaca tamo gde je pre bio samo jedan. Štaviše, sled parova baza tačno će se udvostručiti.”

  28. Šta čini strukturu DNK nezamenjivom u procesima naslednosti? • Jednostavna građa- izgrađena je od samo 4 nukleotida • Mala verovatnoća greške • Linearnai vrlo stabilna struktura, jedino visoka temperatura utiče na denaturaciju DNK. Visoka stabilnost DNK heliksa proističe od velikog broja vodoničnih veza između baznih parova. • Komplementarnost azotnih baza u dvojnoj spirali DNK omogućava da se na dve jednostruke spirale izvrši dogradnja i obrazovanje 2 nove istovetne dvostruke spirale.

  29. Konformacija DNK menja se ( u jednu od 3 forme) zavisno od fizičko – hemijskih uslova i interakcije sa molekulima u okruženju. Cik-cak Uvijena nalevo Ima 12 bp po okretu U proseku 10.4 bp po jednom okretu 11 bp po okretu ne postostoji u in vivo uslovima

  30. Tabela: Broj parova nukleotida, masa i dužina DNK u hromozomima haploidnih ćelija nekih vrsta organizama Što se organizam nalazi na većem stupnju evolutivne lestvice, sadrži više DNK. ????? (daždevnjaci 20× više od ljudi, višak DNK usporio njihovu evoluciju) Genomi prokariota i eukariota se razlikuju po broju ponovljenih nizova nukleotida.

  31. DNK – nosilac genetičkih informacija u ćeliji • DNK u vidu genetičkog zapisa (kod = šifra) prenosi nasledne informacije iz generacije u generaciju To se postiže: • Udvajanjem(duplikacijom = replikacijom) DNK U toku udvajanja može doći do greške-genske mutacije. • Prepisivanjem(transkripcijom) obaveštenja sa molekula DNK na molekule iRNK • Prevođenjem(translacijom) tih obaveštenja sa jezika RNK na jezik aminokoselina, od kojih postaju proteini

  32. Replikacija DNK Najvažnije svojstvo mol. DNK pri ćemu se od jedne originalne DNK stvaraju 2 indentične kćeri. (Polukonzervativni tip replikacije)

  33. Posebni modeli DNK replikacije Konzervativni tip replikacije roditeljska DNK se potpuno održava a mol “kćeri” su novosintetisani. Disperzioni tip replikacije obe DNK mol “kćeri”se sastoje od novosintetisane DNK, dok se roditeljsaka DNK razgrađuje. Polukonzervativni tip replikacije kod roditeljske DNK dolazi do razdvajanja traka (pucanje H veza), a zatim svaka traka služi kao osnova za obrazovanje po 1 nove trake – po principu komplementarnosti

  34. Replikacija • Replikacija se odvija na replikacijskoj viljušci i u njoj učestvuju oba lanca. U sintezi učestvuju enzimi: • DNK i RNK polimeraze, • egzonukleaze, • DNK ligaza • helikaza koja odmotava molekul DNK. • Enzimi helikaze kidaju vodinične veze između N baza dvostrukog lanaca u molekulu DNK. • Odmotavanje lanca pomaže SSB protein koji drži lance odmotane da se ponovo ne vežu (spetljaju).

  35. Replikacija • RNK polimeraza (primaza) stvara RNK-prajmere (kratke segmente od 30 nukleotida; čije prisustvo je uslov za delovanje DNK polimeraze). DNK polimeraza (DNK polimeraza I) sintetiše nove lance u smeru 5---3 • Roditeljski lanac DNK koji je 5---3 smera služi kao predložak-osnova za sintezu kratkih delova novog lanca DNK tzv. okazaki fragmenti, koje enzim DNK-ligaza spaja u tzv. zaostajući lanac (koji će imati 3---5 smer). Dva dobijena lanca savršeno su identični, ali se ponekad u tom procesu mogu pojaviti i greške (mutacije). • DNK se sastoji od jednog originalnog lanca i jednog lanca koji je novo sintetisan. To se naziva semikonzervativna replikacija.

  36. RNK RNK ima ulogu u procesima • prenosa naslednih informacija • sintezi polipeptidnih lanaca • obrazovanju fenotipova organizma

  37. RNK • Proizvod je DNK • RNK sastavljena je od jednog lanca nukleotida • Rasprostranjena je u citoplazmi, ribozomima i jedarcu • Građa RNK je slična DNK - sadrži adenin, guanin, citozin i uracil (U) umesto timina • šećer deziksiriboza zamenjen je ribozom

  38. Hipoteza po kojoj su tokom evolucije molekuli RNK prethodili DNK i proteinima U najranijim ćelijama, pre-RNK molekuli objedinjavali su genetičke, strukturne i katalitičkefunkcije. Ove funkcije su postepeno zamenjivanemolekulima RNK. U danas živećim ćelijama DNKpredstavlja molekul u kome su smeštene genetičke informacije, dok proteini obavljajuvećinu katalitičkih funkcija u ćeliji. Danas RNKfunkcioniše, primarno, kao posrednik u sinteziproteina, mada može imati i katalitičko dejstvo u nekim ključnim reakcijama.

  39. BIOLOŠKI SMISAO EVOLUTIVNOG POSTANKA DNK • DNK je hemijski stabilinija od RNK • dvolančanost DNK omogućuje lakše odvijanje: • replikacije • rekombinacije • reparacije • veća količina nasledne informacije stabilnije se • održava u molekulima DNK nego u RNK • - prisustvo timina umesto uracila olakšava prepoznavanjedeaminacije citozina

  40. Tipovi RNK • Informaciona (messenger) iRNK prenosi nasledne informacije DNK (kodove, povezuje se sa ribozomima i služi kao matrica preme kojoj se sintetišu odgovarajući proteini. Obrazuje se u jedru pod kontrolom DNK. Mol iRNK su kratkog veka. • Ribozomalna rRNK predstavlja strukturne komponente ribozoma. U ribozomima se stvaraju proteini. Svaki ribozom se sastoji od 2 subjedinice: male i velike. Svaka subjedinica sadrži odgovarajuće rRNK i proteine. • Transportna tRNK obavlja aktivaciju aminokiselina. Aktivacija je proces u toku koga se aminokiselina prevodi u oblik koji raspolaže velikom količinom energije. Sastoji se od ciklusa vezivanja i hidrolize dok se ne pronađe odgovarajući par aminokiselina – tRNK.

  41. Transkripcija • Transkripcija je sinteza RNK molekula kao kopije dela jednog lanca DNK (gena) koju katalizuje enzim RNK polimeraza, drugim rečima transkripcija je ništa više do pretvaranja genetske informacije iz oblika DNK u RNK. • Vrši se u jedru eukariota, odnosno nukleoidu prokariota u 5'→ 3' pravcu. • Da bi se izvršila transkripcija (prepisivanje) lanci DNK moraju da se iz spiralno uvijenih prebace u linearni oblik (u ovom koraku DNK molekul izgleda kao merdevine), i zatim se lanci razdvoje, gde jedan od njih služi kao kalup prema kome se ređaju komplementarni nukleotidi RNK: naspram adenina DNK postavlja se uracil RNK, a naspram guanina DNK – citozin RNK: A → U G → C

  42. Transkripcija Transkripcija DNK je ključni korak u prenošenju informacije od DNK do proteina. Sinteza i-RNK počinje kada je ćeliji potreban određeni protein. Novosintetisani lanac RNK je po smeru i po redosledu nukleotida identičan DNK lancu (samo što umesto timina sadrži uracil DNK molekul: 3' AAATTCCCG 5' RNK molekul: 5' UUUAAGGGC 3'

  43. Transkripcija • Kod prokariota prepisana RNK (primarni transkript) se odmah može uključiti u sintezu proteina. Šta više, u in vitro proučavanjima, pokazano je da translacija kod prokariota može da počne dok transkripcija još uvek traje kako nema segregacije genetičkog materijala od ostatka citoplazme. • Kod eukariota se, međutim, transkripti moraju u jedru dodatno obraditi da bi postale zrele RNK sposobne da otpočnu sintezu proteina. Ovaj proces označava se kao obrada primarnog transkripta.

  44. Proteini • Dugački polimeri sastavljeni od aminokiselina povezanih peptidnim vezama. • 20 različitih aminokiselina • Različite sekvence aminokiselina u istom proteinu- varijabilnost- polimorfizam proteina Insulin Enzim Hemoglobin IgG Glutaminska sintetaza

  45. Translacija • Translacija je proces formiranja polipeptidnih lanaca u proteinu na osnovu strukture molekula (iRNK). • Sinteza proteina u ćeliji je složen proces koji se odvija uz učešće ribozoma, i-RNK, t-RNK i velikog broja enzima.  • Ulogu posrednika između kodona i-RNK i aminokiselina imaju t-RNK koje se jednim krajem vezuju za kodon, a drugim za odgovarajuću aminokiselinu. • Redosled aminokiselina zavisi od redosleda nukleotida u iRNK, a ovaj od genetičke informacije, koju je primio od odgovarajućeg gena, tj. od njegovog redosleda nukleotida.

  46. Translacija Prva t-RNK koja ulazi u ribozom je ona sa antikodonom koji je komplementaran start kodonu AUG (metionin)  proces se ponavlja sve dok se u i-RNK ne stigne do stop kodona (UAA, UAG, UGA).

  47. Sinteza proteina • Aktivacijaaminokiselina i njihovo prenošenje do ribozoma • Početak polimerizacije aminokiselina – inicijacija • Obrazovanje peptidnih veza i povećanje polipeptidnog lanca – elongacija • Završetak sinteze i oslobađanje polipeptidnog lanca - terminacija

  48. G E N I Šta je materijalna priroda gena ? Johannsen, 1909 • Proučavanje bakterija i virusa omogućilo je hemijsku indentifikaciju genetičkog materijala, kao i bliže upoznavanje organizacije i uloge gena u nasleđivanju. • Fage su dale neprocenjiv doprinos razumevanju nasleđivanja. • 1922. H.J. MULLER istakao je 2 bitne sličnosti između bakteriofaga i gena, i jedni i drugi su sposobni za : • AUTOREPLIKACIJU • MUTIRANJE