1 / 13

BLAST

BLAST. Introduction to Bioinformatics Anthony Nguyen. BLAST - why?. Sequence alignments provide a powerful way to compare novel sequences with previously characterized genes. Both functional and evolutionary information can be inferred from well designed queries and alignments. BLAST - what?.

errin
Télécharger la présentation

BLAST

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. BLAST Introduction to BioinformaticsAnthony Nguyen

  2. BLAST - why? • Sequence alignments provide a powerful way to compare novel sequences with previously characterized genes. • Both functional and evolutionary information can be inferred from well designed queries and alignments.

  3. BLAST - what? • Basic Local Alignment Search Tool • BLAST provides a method for rapid searching of nucleotide and protein databases.

  4. BLAST - how? • The BLAST algorithm detects local as well as global alignments and regions of similarity embedded in otherwise unrelated proteins can be detected. • Both types of similarity may provide important clues to the function of uncharacterized proteins.

  5. BLAST - advantages • The BLAST algorithm was written balancing speed and increased sensitivity for distant sequence relationships. • BLAST emphasizes regions of local alignment to detect relationships among sequences which share only isolated regions of similarity.

  6. BLAST - programs • blastp • Compares an amino acid query sequence against a protein sequence database.

  7. BLAST - programs • blastn • Compares a nucleotide query sequence against a nucleotide sequence database.

  8. BLAST - programs • blastx • Compares a nucleotide query sequence translated in all reading frames against a protein sequence database. • This option may be used to find potential translation products of an unknown nucleotide sequence.

  9. BLAST - programs • tblastnCompares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames.

  10. BLAST - programs • tblastxCompares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

  11. BLAST - objectives • How long is the target sequence? • What is the most likely identity of the sequence? • What is the source organism, where the sequence is found? • Is the sequence is expressed?

  12. BLAST - query • Getting started… • http://www.ncbi.nlm.nih.gov/ • Unknown Sequence TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATC AGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTC AACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCC TCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGT GCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA

  13. References • http://www.geospiza.com/outreach/BLAST/ • http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/information3.html

More Related