Overview of telomeres & telomerase biology: Clinical implications in cancer and aging

1. Overview of telomeres & telomerase biology: Clinical implications in cancer and aging Meir Lahav MD Laboratory for telomere research, Rabin Medical Center, Beillinson Campus Felsenstein Medical Research Center 8 March 2010

3. Historical perspective • 1908, McClintock & Muller “Chromosome bore a special component at their ends that provided stability” • Telomere: telos- end, meros- part • 1961, Hayflick & Moorehead “Normal somatic cells have a limited life span- a status that is terminated in M1 stage- replicative senescence”. Leonard Hayflick

4. Biological landmarks • 1971, Olovnikov: “Marginotomy”- the end-replication problem may account for the Hayflick limit • 1972, Watson: DNA polymerase could not replicate chromosomes to the tip

5. 5’ 3’ 5’ 3’ 5’ 3’ 3’ 5’ 3’ 5’ 3’ 5’ DNA Replication R R R R R RNA primer removal Fill-in DNA replication Ligation The end-replication problem Each division 50-100 bp loss

6. Biological landmarks (cont.) • 1978, Blackburn discovered telomeres in Tetrahymena (TTGGGG)n • 1984, Blackburn & Greider telomerase activity was detected in Tetrahymena

7. Telomeric end of DNA Genomic DNA Telomere

8. Molecular structure of the telomere

9. Functions of telomere [(TTAGGG)n] • Protects the chromosomal ends from: • Recombination • End-to-end fusion • Recognition as damaged DNA • Enables a complete replication of the DNA • Contributes to the functional organization of chromosomes in the nucleus • Participates in regulation of gene expression • Serves as “mitotic clock”: shortens with each cell division

10. Telomere length in healthy population Uziel et al. 2002

11. Consequences of telomere shortening & damage

13. Two-step hypothesis of cellular senescence and immortalizationWright & Shay Microbiol Mol Biol Rev 2002

14. 5’ TTAGGGTTAG CAAUCCCAAUC Telomerase hTERT hTR-CAAUCCCAAUC telomerase 5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC telomerase 5’ TTAGGGTTAGGGTTAG CAAUCCCAAUC telomerase 5’ TTAGGGTTAGGGTTAGGGTTAG CAAUCCCAAUC telomerase Telomerase

16. Keeping telomerase in its placeMaser & DePinho Nature Medicine 2002

17. The telomere model for cellular transformation Germ cells: telomerase ON Somatic cells: telomerase OFF Telomere length Immortal cells: telomerase ON Oncogenetically transformed cells: bypass senescence, telomerase OFF SenescenceCrisis # of cell divisions

18. TRF measurementsShapiro, Uziel and Lahav 2000 Southern blot FISH flow

19. FISH on paraffin embedded tissues

21. Clinical applications of telomere research

22. Acquired capabilities of cancer (Hanahan and Weinberg, Cell 100: 57-70, 2000)

23. Minimal set of genetic alterations required for conversion of fibroblasts to cancer cells Sun et al 2006 • Malignant conversion: • SV40 large T antigen (p53 and pRb inactivation) • Ras activation • Malignant cells are not immortal - enter crisis and die • Telomerase expression renders cell immortal

24. Telomerase up-regulation cause or consequence • Human cancer cells have • shorter telomeres then normal • dysfunctional telomeres (anaphase bridges, ends fusions etc.,) • Correlation between anaphase bridges and telomere length • Human colorectal cancers show a peak in anaphase bridges index in early lesions;

26. Effect of telomerase inhibition on malignant cells growth

27. Telomerase inhibition in cancer Lahav 2010

28. Chemosensitization by telomeres Lahav 2009

29. Comet assay DNA damage Lahav 2010

30. DNA damage focci telomere dysfunction Lahav 2009

31. Association of telomerase activity with disease free survival in non-small cell lung cancerGonzalez-Quevedo, R. et al. J Clin Oncol. 2002;20:254-262

32. [ThD] mg/ml0 12.5 25 50 100 hTERT IGFI-R b actin CD63 [ThD] mg/ml0 12.5 25 50 100 [ThD] mg/ml0 12.5 25 50 100 hTERT hTERT IGFI-R IGFI-R b actin CD63 CD63 Thalidomide downregulates telomerase promoter gene expression molecular pharmacology Druker, Uziel, Lahav et al. 2004 molec pharmacol ARH-77 RPMI 8226 U266 b actin

33. 0mM 10mM 15mM R8 0 10 15 Kinetics of telomerase activity during Gleevec treatment Inhibition range: 70-90% Gleevec inhibits telomerase activity in SK-N-MC cellsUziel and Lahav,2005 BJC Telomerase activity after Gleevec 5 days treatment

34. Telomerase cellular localization in STI571 treated cellsUziel, Beery et al 2003 Control cells STI571 treated cells

35. Telomerase as a drug target • Significant difference of telomerase expression between malignant and normal tissues • Possible adverse effects: damage to stem and germ cells • Telomerase inhibitors will be effective only when the telomeres shorten to critical length • Will probably be used as an adjuvant therapy

36. Potential effects of telomerase inhibition over time on telomere length and proliferative capacityExperts reviews in molecular medicine 2002

37. Strategies for inhibition of telomerase activity • Telomerase targeting agents: • The RNA template • Reverse transcriptase inhibitors • Modulators of telomerase regulating proteins • Telomeres targeting agents • Inhibitors that interact with G4-DNA structures • Inhibitors against telomeres associated proteins • “Old” DNA -interacting drugs • compounds from random screening

38. Effect of telomerase antisense on malignant cell cultureUziel and Lahav, 2004

39. Antimetastatic effects of GRN163L on pretreated A549-Luc cellsDikmen, Z. G. et al. Cancer Res 2005;65:7866-7873

40. Telomere attrition sensitize SK-N-MC cells to DNA SS breaks inducing agent, CisplatinumUziel and Lahav, 2006 Control +GRN163

41. Telomerase inhibition – future directions • New effective inhibitors • Antitelomerase vaccines • Antitelomerase adoptive immunotherapy • Promoter driven therapy • Development of antitelomerase – cytotoxic drugs – other biologic interventions combinations

42. Telomerase promoter-driven gene therapy • hTERT promoter is highly active in cancer cells (not active in somatic cells) • Expression of harmful genes under the control of hTERT promoter- expression directed to malignant cells • Genes used • Proapoptotic genes: caspase 8, caspase 6, TRAIL, Bax • Prodrugs • Viral lytic genes: adenoviruses

43. Adenovirus and telomerase promoter

44. Telomerase immunotherapy • Immunizing patients against tumor antigens to elicit antibody or cytotoxic T-cells killing of tumor cells • T cells against a short hTERT peptide in vitro and in mouse models in vivo; Somatic cells are not affected • Prostate or breast cancer patients were vaccinated with cells expressing tert peptide; 4 responded; No se. • 12 prostate cancer patients were treated as above, majority responded positively

45. Aging Aging

46. Comparison between a single homologue from one individual and a single homologue from an unrelated individual carrying the same genetic marker

49. Dolly orfailure of resetting the cellular clockWillmut et al, 1997

50. Telomere length & survival rate