1 / 13

Approximate global distribution of West Nile virus

PEER: Skills for Success University of Tennessee-Knoxville West Nile Virus Ethel Stanley BioQUEST , Beloit College Sam Donovan University of Pittsburgh. Approximate global distribution of West Nile virus. Solomon, T. , Brit. Med. J. 326 , 865-869 (2003).

feryal
Télécharger la présentation

Approximate global distribution of West Nile virus

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PEER: Skills for SuccessUniversity of Tennessee-KnoxvilleWest Nile VirusEthel Stanley BioQUEST, Beloit CollegeSam DonovanUniversity of Pittsburgh

  2. Approximate global distribution of West Nile virus Solomon, T.,Brit. Med. J.326, 865-869 (2003)

  3. Clinical course of West Nile encephalitis Solomon, T.,Brit. Med. J.326, 865-869 (2003)

  4. Replication Note: After you click on the link above, choose USA and click GO https://www1.qiagen.com/GeneGlobe/PathwayView.aspx?pathwayID=472 Vaccine http://www3.niaid.nih.gov/news/newsreleases/2005/wnvgraphic.htm CDC- West Nile Virus in Farmed Alligators http://www.cdc.gov/ncidod/EID/vol9no7/03-0085.htm Predicting WNV http://earthobservatory.nasa.gov/IOTD/view.php?id=2172 Global Warming May Lead to More West Nile Virus http://www.scientificamerican.com/article.cfm?id=west-nile-virus-global-warming

  5. http://www.bioquest.org/bedrock/problem_spaces/wnv/

  6. What are our questions?

  7. “It’s called West Nile for a reason. . .”

  8. But where did Israel-98 come from? >Goose99TTCAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTGTCTGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGACTATCATGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATG >Stork98TTTAACTGCCTTGGAATGAGCAACAGAGACTTCTTGGAAGGAGTGTCTGGAGCAACATGGGTGGATTTGGTTCTCGAAGGCGACAGCTGCGTGACTATCATGTCTAAGGACAAGCCTACCATCGATGTGAAGATGATGAATATGGAGGCGG Malkinson,M., Banet,C., Weisman,Y., Pokamunski S, King,R., Drouet, M.T. and Deubel, V. 2002. Introduction of West Nile virus in the Middle East. Journal Emerging Infect. Dis. 8 (4): 392-397. Banet-Noach, C., Malkinson, M., Brill, A., Samina, I., Yadin, H., Weisman, Y., Pokamunski, S., King, R., Deubel, V. and Stram, Y. 2003. Phylogenetic relationships of West Nile viruses isolated from birds and horses in Israel from 1997 to 2001. Journal Virus Genes 26 (2), 135-141.

  9. The stork brought it…

More Related