galen
Uploaded by
1 SLIDES
138 VUES
10LIKES

Genetic Diversity and Stock Structure Analysis of Atlantic Herring (Clupea harengus)

DESCRIPTION

This study investigates the genetic diversity and stock structure of Atlantic herring (Clupea harengus) in the Irish Sea and nearby regions. Through a multidisciplinary approach combining fisheries techniques and genomic analysis, we aim to differentiate spawning aggregations and evaluate genetic variation among different populations. Preliminary findings highlight the presence of distinct haplotypes related to the geographical distribution of herring and associated Anisakis spp. parasites. The results aim to enhance fisheries management and conservation strategies for this economically significant resource.

1 / 1

Download Presentation
Télécharger la présentation

Genetic Diversity and Stock Structure Analysis of Atlantic Herring (Clupea harengus)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Locus Motif Primer sequence (5'-3') Size range GeneBank ATCT Cpa101 F: CATTGCCACCTACTGACCTG R: CACCCTGAAGATGATGAGGA 182-324 AF406937 13 ATCT N ATCT Cpa106 F: CCATCCTCATCAAGAAAGCA R: GGTACTTTGACCTCTCCTCTCC 169-233 AF406942 10 4 10 ATCT Cpa107 F: ATGATTTTTCGCCTTTTGCT R: CCCAGAAACAAGAGCTAGGC 165-281 AF406943 19 TAGA Cpa111 F: TGTCCAGTAAAACATGCCTGA R: GCTCCGTTCTCTTTCTTGCT 232-308 AF406947 8 TAGA Cpa112 F: GAGAGGGAGTTAAAATTGACAGC R: GGCACAAGATGAGAGTGCAG 256-468 AF406948 7 ATCT Cpa113 F: TGTCCATCTGTCCATTCAGC R: ACCACACAGCACATTTACAGG 130-194 AF406949 17 ATCT Cpa114 F: GCGTTTGTCCATACCACATT R: CAGCTCTGAAAACCCAGACA 201-265 AF406950 10 (GACA) Cpa4 F: CTTATCTGTCTGACTGCCTATTTG R: GTTTCTTCTCTGCTCCACCCAGAA 97-180 AF309800 10 (GATA) Cpa6 F: GTGTGAGTTTGCTCCAAA R: GTTTGTACCAATGAATGATTACAA 141-251 AF309801 14 cha1020 GACA F: CCTGGAGAGACAGATAGAAAA R: GAGTTTAGCAGACGCTTTA 160-224 AF289095 cha1202 GACA F: TTTCCGTTACACTTTCACATCG R: GTGCCTCAGTTTTCACATACA 92-148 AF304363 cha1059 GACA F: CATCTACCACCTCCGACTCC R: AATCTAAAGGAAGCCCACTC 66-108 AF289094 Cha1027 GACA F: ATTCAACCCCCTCACAGA R: TGAGGCAGCAGACGATACAC 110-202 AF290885 Cha1017 GATA F: GGTCTCATTATCTTCTCACTCTTTTG R: TCTCCCTATGTGTATTGTTTTACTGTG 162-206 AF289096 Baltic03 Baltic04 C. Wrath Clyde Baltic04 -0.02313 CapeWrath 0.02443* -0.00014 Clyde 0.00668 -0.02287 -0.0091 Donegal 0.0287* 0.01429* 0.00562 -0.00381 CelticSea 0.00415 -0.02611 -0.04816 -0.08734 WESTHER: A FISHY PROBLEM S. Kay1*, M.A. Cross1†, N. Campbell2†, J.C. Chubb1†, C. Collins3†, J. Coughlan4*, T. Cross4*, C.O. Cunningham3†, K. Mackenzie2†, D. O’Leary4*, P.C Watts1*†, S. Wylde4* & E. Hatfield3 . * = HERRING GENOME ANALYSIS † = PARASITE GENOME ANALYSIS 1School of Biological Sciences, The University of Liverpool, Crown Street, Liverpool L69 7BZ; 2School of Biological Sciences, The University of Aberdeen, Tillydrone Avenue, Aberdeen AB24 2TZ; 3FRS Marine Laboratory, PO Box 101, 375 Victoria Road, Aberdeen AB11 9DB; 4Zoology, Ecology and Plant Science, National University of Ireland, Lee Maltings, Prospect Row, Cork, Ireland. http://www.clupea.net/westher INTRODUCTION Atlantic herring, Clupea harengus L., form the basis of a number of economically important European (EU) fisheries. The successful management of this resource to the west of the British Isles is dependent on an understanding of their stock structure because herring are highly migratory and it is not unusual for them to be caught outside their traditional management units. WESTHER is an EU funded multidisciplinary project that combines traditional fisheries techniques with modern population genetics. Our goal is to describe the structure of herring stocks from the Irish Sea to the north coast of Scotland (Figure 1). Through the genomic analysis of herring and their parasites we aim to differentiate between spawning aggregations, thereby creating reference points to help describe juvenile and mixed adult aggregations. Preliminary comparisons have been made with outlier samples from the Western Baltic and Northern Norway. Through an accurate description of the stock structure we hope to contribute to the management and sustainability of the fisheries and to the conservation of their biodiversity. Figure 1. Sampling Locations HERRING GENOME ANALYSIS ANISAKIS spp. GENOME ANALYSIS We are characterising genetic variation of C. harengus from each of the spawning areas, juvenile aggregations and fishery grounds designated in Figure 1. These data will be used to determine the extent of genetic separation among putative stock and also link individuals from nurseries and adults taken by in the targeted fisheries to their spawning stocks. All sampling is being repeated over two years targeting largely different cohorts, to assess the temporal stability of allele frequencies. A common parasitic nematode of herring are Anisakis spp. larvae. These are a group of morphologically similar sibling species. Larval Anisakis are excised from their herring hosts (Figure 2). Approximately 1000 bases of the mtDNA CO1 Region has been sequenced from individual parasites from different herring samples. Polymorphic sites distinguishing different haplotypes have been identified. Herring DNA is extracted from fin clips or liver samples. Genotypes are characterised across 12-14 microsatellite loci (Table 1). Structure of spawning adults will be assessed using Bayesian population genetic statistics, e.g. STRUCTURE (Pritchard et al. 2000) & PARTITION (Dawson & Delkhir 2001), as well as through general multivariate statistical analysis. Figure 2. C. harengus infected with L3 Anisakis spp. RESULTS Preliminary analysis of Anisakis spp. From two geographically distinct areas (Western Baltic and Irish Sea) has found a total of eight polymorphic sites over a 250 base sequence of the CO1 region. Three haplotypes were identified from Irish Sea parasites and six haplotypes from the Western Baltic samples. No common haplotypes were found between the two areas (Table 3.). Table 1. Summary characteristics of the 14 microsatellite loci used to genotype C. harengus in WESTHER Table 3. Nucleotide polymorphisms identifying different CO1 haplotypes FUTURE WORK PRELIMINARYRESULTS To-date only a few parasites, from different locations, have been investigated, therefore these results are only preliminary. An increase in the number of samples analysed from the whole study area, and in consecutive years, will show if the observed haplotype variations are representative of discrete groupings of Anisakis spp. and therefore discrete host (C. harengus) populations, or a natural inherent variability in Anisakis’s CO1 gene over the whole study area. Preliminary analyses of spawning adult samples indicate low levels of genetic variation among stocks from the western British Isles. There are significant genetic differences between some spawning aggregations from the western British Isles and the Baltic (Table 2). Table 2. Pairwise FST among four samples of C. harengus THIS PROJECT IS FUNDED BY THE EUROPEAN UNION UNDER THE 5TH FRAMEWORK, CONTRACT NO. QLRT-2001-01056

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer