ganit
Uploaded by
53 SLIDES
800 VUES
550LIKES

SNPs Future Application

DESCRIPTION

SNPs Future Application. Where have we been….. ….where are we going?. Diagnostics in the Past. Have you had this before?. …..Well you’ve got it again !. Restriction Length Polymorphism. Reverse Blot Hybridization. STR (Short Tandem Repeats). CCTAC ATTG ATTG ATTG ATTG ATTG AAGCA.

1 / 53

Télécharger la présentation

SNPs Future Application

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. SNPsFuture Application

  2. Where have we been….. ….where are we going?

  3. Diagnostics in the Past Have you had this before? …..Well you’ve got it again !

  4. Restriction Length Polymorphism

  5. Reverse Blot Hybridization

  6. STR (Short Tandem Repeats) CCTACATTG ATTG ATTG ATTG ATTG AAGCA

  7. ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG Down to level of DNA seq

  8. ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG Down to level of DNA seq

  9. ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG Mitochondrial DNA • Relatively small circular DNA molecule • Treated as one loci • Differences in sequence treated as alleles

  10. SNPs (Single Nucleotide Polymorphisms) • Polymorphisms that differ by one base pair • Typically Bi-allelic • Estimated to be approximately 3,000,000 in the Human genome • May be useful in Gene Mapping, Medical Diagnostic and Forensic applications

  11. ATCGTACGGTTTAAAAGCCTAGTCAGCTTACGG ATCGTACGGTTTAAAGGCCTAGTCAGCTTACGG ATCGTACGGTTTAAACGCCTAGTCAGCTTACGG ATCGTACGGTTTAAATGCCTAGTCAGCTTACGG Allele 1 Allele 2 Allele 3 Allele 4

  12. Forensic Applications

  13. Forensic Applications

  14. SNP Detection

  15. SNP Detection

  16. SNP Detection

  17. Will SNPs Replace STRs

  18. Will SNPs Replace STRs Science & Justice Volume 44 No.1 (2004) 51 - 53 Peter Gill FSS David J. Werrett Bruce Budowle FBI Richard Guerrieri

  19. Will SNPs Replace STRs • Databases already exist and would be costly to replaced in ever jurisdiction • Cost is not a clear advantage at this point • Extensive multiplexing (50 to 100 loci) would be required for forensic samples

  20. Will SNPs Replace STRs • Mixtures would be hard to interpret given the limited number of alleles at each SNP • Low copy number analysis may produce big problems like allelic drop etc…. • Probably used in specialized situations - mtDNA, Y, eye color, mass disaster

  21. Will SNPs Replace STRs “..……Neither mass-disaster nor paternity analysis is dependent upon national DNA databases. This means that for the initial introduction, standardization is not a necessity. Provided that analyses are carried out using the same set of loci then standardization is achieved by default on a per-case basis……”

  22. Will SNPs Replace STRs “…..The process of standardization can follow a specific route proposed here. It will require co-ordination by a committee of experts. In Europe, experts will be drawn from the ENFSI and in North America experts will be drawn from SWGDAM. These will comprise the SNP standardization group. Information flow will follow by exchange of ENFSI members and SWGDAM members at each other’s meetings. Eventually, a standard set of loci will be chosen by mutual agreement……”

  23. Determination of Ancestral Affiliation and Physical Characteristics

  24. “Fast-breeding, slow-flying fruit flies are much easier to study than highly mobile mammals with 25 years between generations whose common ancestry goes back tens of thousands of years. “ John Relethford (SUNY Oneonta, N.Y) - Genes generate a map; Monday, June 9, 2003

  25. Requirement • Markers • Accurate understanding of: - Evolution - Migration - Ancestral Groups - Phenotype

  26. Markers

  27. Markers

  28. Evolution ? • Still debate here, but a sharper picture as time goes by

  29. Evolution and Migration • Single Origin • Multi-Regional

  30. STR and Y-Chromosome Studies • Timing of the critical first branching harder to estimate than later branches that shaped modern Homo sapiens. • Hunter-gatherers in Africa diverged from a common ancestral population between 70,000 years and 140,000 years ago • Expanded out of Africa to Eurasia, East Asia, Oceania and last to the Americas

  31. STR and Y-Chromosome Studies • A genetically distinct group of sub-Saharan farmers appeared 7,000 to 10,000 years after hunter-gatherers became established and migrated to Eurasia 13,000 to 19,000 years later • Y-Chromosome studies indicate that migration out of Africa happened about 66,000 years ago. • Latest studies suggest the size of this original group must have been tiny, no more than 2,000 individuals.

  32. Phenotype ?

  33. Test for Ancestral Inference • 176 SNPs - Ancestry Informative Markers (AIM) • - Majority in Pigmentation and Xenobiotic • Metabolism genes • Automated Sequencing of SNPs to generate genotypes • Classifier (percent affiliation) - Four anthropologic groups • - Native American, European, sub-Saharan African, East Asian

  34. Issues for Discussion • Accuracy: • -In the range of 1 in 100 misclassifications • - Probably only suitable for Inference of Major Ancestral Affiliation • Presumptive?

  35. Issues for Discussion • Contributing to Accuracy Issues: • - Self reporting • - Admixture • - Unpredicted mixtures • - Linkage

  36. Issues for Discussion • Confusing Race with Ancestry • - Race to some extent is becoming meaningless • - Distinctions between groups are growing fuzzy • - Variations between individuals within a “Race” may be more pronounced than differences between one races

  37. “ We are all mixed up, part of the same family tree originally, who then evolved, then were together and mixed up again.” • Mark Shriver, assistant professor of anthropology and genetics at Penn State University

  38. Issues for Discussion • Use for probable cause • Dragnets

  39. Issues for Discussion • Use of such tests to delineate which Racial groups to select for Match Statistics • Will this be fair to individuals or groups possessing high degrees of Ancestral Homogeneity?

  40. Issues for Discussion • Which Racial group will we use for Match Statistics when an individual has a high degree of Ancestral Heterogeneity? • Will we need to revisited old cases?

  41. Issues for Discussion • Cost$ • - What will they be? • - Will such expenditures be justifiable in light of testing backlogs and tight budgets?

More Related