gen
Uploaded by
11 SLIDES
321 VUES
110LIKES

Hebrews 12:28

DESCRIPTION

Hebrews 12:28 28 Wherefore we receiving a kingdom which cannot be moved, let us have grace, whereby we may serve God acceptably with reverence and godly fear:. Transposons. Timothy G. Standish, Ph. D. Dynamic Genomes. Many changes in the genetic material are known to be deleterious

1 / 11

Télécharger la présentation

Hebrews 12:28

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Hebrews 12:28 28 Wherefore we receiving a kingdom which cannot be moved, let us have grace, whereby we may serve God acceptably with reverence and godly fear:

  2. Transposons Timothy G. Standish, Ph. D.

  3. Dynamic Genomes • Many changes in the genetic material are known to be deleterious • The more dramatic the change, in general the more catastrophic the outcome • Thus rearrangements of DNA have traditionally been viewed as unnatural and dangerous things • Discovery of transposons has given us a new far more dynamic perspective on genomes perspective on genomes within which segments of DNA naturally move about

  4. Transposons And Evolution • Much of the increase in genome size evident when simpler organisms are compared with more complex ones is attributed to gene duplication some of which is attributed to transposons • Transposons are also thought to have played a role in rearranging genomes • P elements, a kind of transposon found in Drosophila, are thought to exhibit a mechanism for reproductive isolation and thus to play a role in evolution of new species

  5. Basic Structure Genome Transposon Genome Target sequence direct repeat Target sequence direct repeat Inverted repeats (part of transposon) • The simplest trasposons are called Insertion Sequences which are commonly found in bacteria • Insertion sequences are named using the abbreviation IS followed by a number • The location of an IS is given followed by a double colon then the insertion sequence name • l ::IS1 is IS1 located in the l genome

  6. Mode of Insertion Nick Transposase TGAATACTA ACTTATGAT Nick Target sequence

  7. Mode of Insertion Insertion sequence GGTAAT CCATTA ATTACC TAATGG T ACTTATGA GAATACTA T

  8. Mode of Insertion Direct repeat Direct repeat T ACTTATGA GGTAAT CCATTA ATTACC TAATGG GAATACTA T Insertion sequence GAATACT CTTATGA Regular DNA repair machinery of the cell may take over, fill in gaps repair nicks thus completing incorporation of the IS

  9. Overlap between Ins A and B The IS1 Sequence Overlap between Ins A and B Inverted repeat Ins B Transposase Ins A Repressor? Inverted repeat Ins B Transposase Ins A Repressor? gaggtattattctcaggtaatgactccaacttactgatagtgttttatgttcagataatgcccgatgaccttgtcatgcagctccaccgattttgagaacgacagtgacttccgtcccagccttgccagatgttgtctcagattcagattatgtcgctcaatgcgctgagtgtaacgcttgctgataacgtgcagctttcccttcaggcgtgattcatacagcggccagccatccgtcatccataccacgacctcaaaggccgacagcaggctcagaagacgctccagtgtggccagagtgcgttcaccgaagacgtgcgccacaaccgtcctccgtatcctgtcatacgcgtaaaacagccagcgctgacgtgatttagcaccgacgtagccccactgttcgtccatttcagcgcagacaatcacatcactgcccggttgtatgcgcgaggttaccgactgcggcctgagttttttaagtgacgtaaaaccgtgttgaggccaacgcccataatgcgtgcactggcgcgacatccgacgccattcatggccatatcaatgattttctggtgcttaccgggctgagaggcggtgtaagtgaactgtagttgccatgttttacggcaaggagagcagagatagcgctgatgtccggcagtgcttttgccgttacgcaccacgccttcagtagcggagcaggaaggacatctgatggaaatggaagccacgcaagcaccttaaaatcaccatcatacactaaatcagtaagttggcagcattacccactatcgtatggaat

  10. The Ins B Gene aug-ucg-cgc-cag-ugc-acg-cau-uau-ggg-cgu-ugg-ccu-caa-cac- ggu-uuu-acg-uca-cuu-aaa-aaa-cuc-agg-ccg-cag-ucg-gua-acc- ucg-cgc-aua-caa-ccg-ggc-agu-gau-gug-auu-guc-ugc-gcu-gaa- aug-gac-gaa-cag-ugg-ggc-uac-guc-ggu-gcu-aaa-uca-cgu-cag- cgc-ugg-cug-uuu-uac-gcg-uau-gac-agg-aua-cgg-agg-acg-guu- gug-gcg-cac-guc-uuc-ggu-gaa-cgc-acu-cug-gcc-aca-cug-gag- cgu-cuu-cug-agc-cug-cug-ucg-gcc-uuu-gag-guc-gug-gua-ugg- aug-acg-gau-ggc-ugg-ccg-cug-uau-gaa-uca- Met Ser Arg Gln Cys Thr His Tyr Gly Arg Trp Pro Gln His Gly Phe Thr Ser Leu Lys Lys Leu Arg Pro Gln Ser Val Thr Ser Arg Ile Gln Pro Gly Ser Asp Val Ile Val Cys Ala Glu Met Asp Glu Gln Tro Gly Tyr Val Gly Ala Lys Ser Arg Gln Arg Trp Leu Phe Tyr Ala Tyr Asp Arg Ile Arg Arg Thr Val Ala Thr Leu Glu Arg Leu Leu Ser Leu Leu Ser Ala Phe Glu Val Ala His Val Phe Gly Glu Arg Thr Leu Val Val Val Trp Met Thr Asp Gly Trp Pro Leu Tyr Glu Ser

  11. The End

More Related