70 likes | 224 Vues
Essential Basic Part Types. Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon (type II), a start codon (type III), or both (type IV)
E N D
Essential Basic Part Types Coding Sequences (C) - Complete open reading frames (type I), or sequences encoding polypeptides but lacking either a stop codon (type II), a start codon (type III), or both (type IV) Ribosome Binding Sites (RBS) - Sequence encoding a ribosome binding site, fused 5' to an ORF part Terminators (TT) - Sequence causing transcription termination (and more can come later, with their own part definitions and standards rules)
Potter Standard Polylinker GAATTCaaaAGATCTPARTSEQUENCE1GGATCCaaaCTCGAG AGATCTPARTSEQUENCE1GGATCC AGATCTPARTSEQUENCE2GGATCC GlySer AGATCTPARTSEQUENCE1GGATCTPARTSEQUENCE2GGATCC
Type I Coding Sequences AGATCTATG_MIDDLE_OF_PART_TAAGGATCC AGATCTGTG_MIDDLE_OF_PART_TGAGGATCC • The start and stop codons are placed directly adjacent to the BglII and BamHI sites, respectively • Start codons are free to be ATG, CTG, TTG, or GTG
Coding Sequences Type II AGATCTATGAAATTTCCCGGGAAATTTGGATCC Type III AGATCTCATCATCATCATCATCATTAAGGATCC Type IV AGATCTAAATTTCCCGGGAAATTTCCCGGATCC • Coding sequences allow the construction of ORF fusions for chimeric and tagged proteins. GlySer scars separate junctions between fused peptides.
Ribosome Binding Sites AGATCTGAAAGAGGAGAAAGGATCC • The spacing of a ribosome binding site relative to the start codon is fixed. Shown is a (likely) strong RBS AGATCTATG_ORF_Part_TAAGGATCC .RBS. AGATCTGAAAGAGGAGAAAGGATCTATG_ORF_Part_TAAGGATCC
Promoters +1 | AGATCTTCC_Middle_of_Ptet_TAGAGATACTGAGCACGGATCC • The transcriptional start site (+1) is located at the position directly 5' to the BamHI site (whenever possible)
Terminators ...CUUUCUGCGUUUAUA3' | AGATCTCCA_Middle_of_Ptet_CTTTCTGCGTTTATAGGATCC • The transcriptional termination site is located at the position directly 5' to the BamHI site (whenever possible)